Starting /dee2/code/volunteer_pipeline.sh SRR6322398 current disk space = 1543652892672 free memory = 1597852688 SRR6322398 SRAfilesize 50fca5ae88be212dc0ebea5f9b01cb20 SRR6322398.sra SRR6322398.sra file validated SRR6322398 is single end SRR6322398 is conventional basespace SRR6322398 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322398_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35925 33.0 33.0 34.0 31.0 34.0 2 32.51875 33.0 33.0 34.0 31.0 34.0 3 32.591 34.0 33.0 34.0 31.0 34.0 4 32.48375 34.0 33.0 34.0 31.0 34.0 5 32.53475 34.0 33.0 34.0 31.0 34.0 6 36.18775 38.0 37.0 38.0 33.0 38.0 7 36.66025 38.0 37.0 38.0 34.0 38.0 8 36.661 38.0 38.0 38.0 34.0 38.0 9 36.7635 38.0 38.0 38.0 35.0 38.0 10 36.8195 38.0 38.0 38.0 34.0 38.0 11 36.8795 38.0 38.0 38.0 35.0 38.0 12 36.9025 38.0 38.0 38.0 35.0 38.0 13 36.84075 38.0 38.0 38.0 35.0 38.0 14 36.7115 38.0 38.0 38.0 34.0 38.0 15 36.68475 38.0 38.0 38.0 34.0 38.0 16 36.66125 38.0 38.0 38.0 34.0 38.0 17 36.7465 38.0 38.0 38.0 34.0 38.0 18 36.9 38.0 38.0 38.0 35.0 38.0 19 36.80825 38.0 38.0 38.0 34.0 38.0 20 36.64675 38.0 38.0 38.0 34.0 38.0 21 36.666 38.0 38.0 38.0 34.0 38.0 22 36.6665 38.0 38.0 38.0 34.0 38.0 23 36.48925 38.0 38.0 38.0 34.0 38.0 24 36.63675 38.0 38.0 38.0 34.0 38.0 25 36.63425 38.0 38.0 38.0 34.0 38.0 26 36.7035 38.0 38.0 38.0 35.0 38.0 27 36.64 38.0 38.0 38.0 34.0 38.0 28 36.659 38.0 38.0 38.0 34.0 38.0 29 36.7845 38.0 38.0 38.0 34.0 38.0 30 36.76825 38.0 38.0 38.0 35.0 38.0 31 36.69225 38.0 38.0 38.0 35.0 38.0 32 36.77625 38.0 38.0 38.0 35.0 38.0 33 36.679 38.0 38.0 38.0 34.0 38.0 34 36.822 38.0 38.0 38.0 35.0 38.0 35 36.72525 38.0 38.0 38.0 34.0 38.0 36 36.61725 38.0 38.0 38.0 34.0 38.0 37 36.611 38.0 38.0 38.0 34.0 38.0 38 36.65325 38.0 38.0 38.0 34.0 38.0 39 36.599 38.0 38.0 38.0 34.0 38.0 40 36.6635 38.0 38.0 38.0 35.0 38.0 41 36.56875 38.0 38.0 38.0 34.0 38.0 42 36.6435 38.0 38.0 38.0 34.0 38.0 43 36.556 38.0 38.0 38.0 34.0 38.0 44 36.56175 38.0 38.0 38.0 34.0 38.0 45 36.497 38.0 38.0 38.0 34.0 38.0 46 36.315 38.0 38.0 38.0 33.0 38.0 47 36.48225 38.0 38.0 38.0 34.0 38.0 48 36.4465 38.0 38.0 38.0 34.0 38.0 49 36.2785 38.0 38.0 38.0 34.0 38.0 50 36.25275 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 3.0 18 1.0 19 0.0 20 3.0 21 0.0 22 2.0 23 3.0 24 3.0 25 10.0 26 15.0 27 25.0 28 40.0 29 42.0 30 61.0 31 82.0 32 96.0 33 133.0 34 173.0 35 224.0 36 540.0 37 2539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.67741935483871 15.650201612903224 8.215725806451612 41.45665322580645 2 25.15 22.575 34.225 18.05 3 20.825 25.174999999999997 23.325000000000003 30.675 4 25.825 31.574999999999996 19.3 23.3 5 24.25 32.775 21.325 21.65 6 20.424999999999997 31.724999999999998 22.0 25.85 7 17.849999999999998 16.55 40.675 24.925 8 22.650000000000002 20.1 25.85 31.4 9 19.75 19.35 30.65 30.25 10 23.45 32.775 21.05 22.725 11 29.375 20.9 19.725 30.0 12 26.200000000000003 18.325 23.150000000000002 32.324999999999996 13 22.45 23.474999999999998 24.575 29.5 14 22.95 24.825 26.200000000000003 26.025 15 23.724999999999998 25.55 25.374999999999996 25.35 16 23.925 25.35 23.525 27.200000000000003 17 24.099999999999998 26.950000000000003 25.0 23.95 18 23.575 25.650000000000002 25.25 25.525 19 25.424999999999997 24.825 24.15 25.6 20 23.95 26.474999999999998 24.975 24.6 21 22.45 25.724999999999998 25.5 26.325 22 24.3 25.05 24.575 26.075 23 23.799999999999997 26.55 25.6 24.05 24 22.875 25.624999999999996 25.650000000000002 25.85 25 23.5 24.975 24.55 26.974999999999998 26 21.2 25.75 26.724999999999998 26.325 27 23.375 24.4 25.275 26.950000000000003 28 24.625 24.6 24.575 26.200000000000003 29 23.875 26.05 24.325 25.75 30 23.674999999999997 25.275 25.224999999999998 25.825 31 24.625 25.2 23.875 26.3 32 23.825 25.0 25.174999999999997 26.0 33 22.725 24.725 26.3 26.25 34 23.599999999999998 26.3 23.225 26.875 35 22.8 26.125 24.525 26.55 36 22.125 27.250000000000004 25.275 25.35 37 24.9 26.55 23.5 25.05 38 23.375 26.025 25.0 25.6 39 22.900000000000002 23.799999999999997 26.8 26.5 40 24.2 24.975 23.375 27.450000000000003 41 23.025000000000002 25.650000000000002 25.424999999999997 25.900000000000002 42 23.75 24.825 24.575 26.85 43 24.0 25.775 23.925 26.3 44 23.3 26.224999999999998 25.45 25.025 45 22.875 25.25 25.05 26.825 46 25.474999999999998 24.5 24.675 25.35 47 23.599999999999998 24.975 25.074999999999996 26.35 48 23.599999999999998 25.2 24.95 26.25 49 24.3 25.3 24.075 26.325 50 23.799999999999997 24.675 25.775 25.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 3.5 24 5.0 25 7.5 26 10.0 27 15.5 28 21.0 29 25.0 30 29.0 31 37.5 32 46.0 33 66.0 34 86.0 35 103.0 36 120.0 37 160.0 38 200.0 39 221.0 40 242.0 41 244.0 42 246.0 43 270.5 44 295.0 45 297.5 46 300.0 47 303.5 48 307.0 49 314.5 50 322.0 51 323.0 52 324.0 53 297.0 54 270.0 55 240.0 56 210.0 57 210.0 58 210.0 59 179.5 60 149.0 61 145.0 62 141.0 63 123.0 64 105.0 65 98.0 66 91.0 67 89.0 68 87.0 69 71.5 70 56.0 71 46.5 72 37.0 73 37.0 74 37.0 75 31.0 76 25.0 77 17.0 78 9.0 79 9.0 80 9.0 81 4.5 82 0.0 83 2.0 84 4.0 85 3.5 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93509127789046 97.55 2 0.9127789046653144 1.7999999999999998 3 0.07606490872210953 0.22499999999999998 4 0.02535496957403651 0.1 5 0.02535496957403651 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02535496957403651 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGAC 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982157 spots for SRR6322398.sra Written 982157 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra Read 982143 spots for SRR6322398.sra Written 982143 spots for SRR6322398.sra SRR ids: ['SRR6322398.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cltsrgkr SRR6322398.sra spots: 19642874 blocks: [[1, 982143], [982144, 1964286], [1964287, 2946429], [2946430, 3928572], [3928573, 4910715], [4910716, 5892858], [5892859, 6875001], [6875002, 7857144], [7857145, 8839287], [8839288, 9821430], [9821431, 10803573], [10803574, 11785716], [11785717, 12767859], [12767860, 13750002], [13750003, 14732145], [14732146, 15714288], [15714289, 16696431], [16696432, 17678574], [17678575, 18660717], [18660718, 19642874]] SRR6322398 file size 3412994 SRR6322398 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322398 SRR6322398_1.fastq Input file: SRR6322398_1.fastq trimmed: SRR6322398-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:22:52 2024 >> started Sat Dec 7 10:23:04 2024 >> done (12.113s) 19642874 reads processed; of these: 8042 ( 0.04%) short reads filtered out after trimming by size control 32935 ( 0.17%) empty reads filtered out after trimming by size control 19601897 (99.79%) reads available; of these: 346819 ( 1.77%) trimmed reads available after processing 19255078 (98.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 386 0.00% 19 347 0.00% 20 433 0.00% 21 455 0.00% 22 524 0.00% 23 616 0.00% 24 813 0.00% 25 1014 0.01% 26 1063 0.01% 27 1151 0.01% 28 1463 0.01% 29 2097 0.01% 30 9870 0.05% 31 5124 0.03% 32 3817 0.02% 33 3824 0.02% 34 3894 0.02% 35 4006 0.02% 36 4528 0.02% 37 4975 0.03% 38 5475 0.03% 39 6439 0.03% 40 7442 0.04% 41 8931 0.05% 42 10835 0.06% 43 13479 0.07% 44 16594 0.08% 45 20740 0.11% 46 27417 0.14% 47 38784 0.20% 48 58476 0.30% 49 81807 0.42% 50 19255078 98.23% 19601897 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.08 prefix-fanout=2.0 sequence=CAGGGACAGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=97.68 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCT Started job on | Dec 07 10:23:23 Started mapping on | Dec 07 10:23:23 Finished on | Dec 07 10:23:40 Mapping speed, Million of reads per hour | 4150.99 Number of input reads | 19601897 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18040272 Uniquely mapped reads % | 92.03% Average mapped length | 49.82 Number of splices: Total | 2685654 Number of splices: Annotated (sjdb) | 2587245 Number of splices: GT/AG | 2653385 Number of splices: GC/AG | 27007 Number of splices: AT/AC | 1371 Number of splices: Non-canonical | 3891 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 517841 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 911350 % of reads mapped to too many loci | 4.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1043784 1043784 1043784 N_multimapping 517841 517841 517841 N_noFeature 753661 17674368 871198 N_ambiguous 264365 1216 16287 UnstrandedReadsAssigned:17022246 PositiveStrandReadsAssigned:364688 NegativeStrandReadsAssigned:17152787 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322398 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322398-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,601,897 reads, 17,077,063 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 SRR6322398.ke.tsv 35125 SRR6322398.se.tsv 88098 total ==> SRR6322398.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 72.4048 8.85806 PNS24247 1044 945 11.0959 1.20234 PNS24249 1928 1829 24.0131 1.34441 PNS24246 1044 945 11.0959 1.20234 PNS24248 1044 945 11.0959 1.20234 PNS24244 1471 1372 54.2943 4.05226 PNS24243 293 194 0 0 KQK14069 1603 1504 4.27992 0.291397 KQK14071 474 375 6.38003 1.74216 ==> SRR6322398.se.tsv <== BRADI_1g14170v3 16 BRADI_1g53295v3 13 BRADI_1g59795v3 301 BRADI_1g07683v3 0 BRADI_1g00485v3 862 BRADI_1g20270v3 5228 BRADI_1g74790v3 1 BRADI_1g09890v3 0 BRADI_1g77505v3 81 BRADI_1g48960v3 0 SRR6322398 completed mapping pipeline successfully