Starting /dee2/code/volunteer_pipeline.sh SRR6322399 current disk space = 1543525421056 free memory = 1595257544 SRR6322399 SRAfilesize f60bcb136752f71b87a405aa0131f514 SRR6322399.sra SRR6322399.sra file validated SRR6322399 is single end SRR6322399 is conventional basespace SRR6322399 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322399_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44725 33.0 33.0 34.0 31.0 34.0 2 32.5095 33.0 33.0 34.0 31.0 34.0 3 32.533 34.0 33.0 34.0 31.0 34.0 4 32.4815 34.0 33.0 34.0 31.0 34.0 5 32.45225 34.0 33.0 34.0 31.0 34.0 6 36.15475 38.0 37.0 38.0 31.0 38.0 7 36.62625 38.0 37.0 38.0 34.0 38.0 8 36.67275 38.0 38.0 38.0 34.0 38.0 9 36.756 38.0 38.0 38.0 34.0 38.0 10 36.72575 38.0 38.0 38.0 34.0 38.0 11 36.82575 38.0 38.0 38.0 35.0 38.0 12 36.80575 38.0 38.0 38.0 35.0 38.0 13 36.67575 38.0 38.0 38.0 34.0 38.0 14 36.71925 38.0 38.0 38.0 34.0 38.0 15 36.716 38.0 38.0 38.0 34.0 38.0 16 36.722 38.0 38.0 38.0 34.0 38.0 17 36.7465 38.0 38.0 38.0 34.0 38.0 18 36.76925 38.0 38.0 38.0 35.0 38.0 19 36.7435 38.0 38.0 38.0 35.0 38.0 20 36.739 38.0 38.0 38.0 34.0 38.0 21 36.72625 38.0 38.0 38.0 34.0 38.0 22 36.76225 38.0 38.0 38.0 35.0 38.0 23 36.75525 38.0 38.0 38.0 35.0 38.0 24 36.6725 38.0 38.0 38.0 34.0 38.0 25 36.69275 38.0 38.0 38.0 34.0 38.0 26 36.6555 38.0 38.0 38.0 34.0 38.0 27 36.69475 38.0 38.0 38.0 34.0 38.0 28 36.65125 38.0 38.0 38.0 34.0 38.0 29 36.77225 38.0 38.0 38.0 35.0 38.0 30 36.6455 38.0 38.0 38.0 34.0 38.0 31 36.64 38.0 38.0 38.0 34.0 38.0 32 36.65825 38.0 38.0 38.0 34.0 38.0 33 36.673 38.0 38.0 38.0 34.0 38.0 34 36.545 38.0 38.0 38.0 34.0 38.0 35 36.6445 38.0 38.0 38.0 34.0 38.0 36 36.444 38.0 38.0 38.0 34.0 38.0 37 36.533 38.0 38.0 38.0 34.0 38.0 38 36.54975 38.0 38.0 38.0 34.0 38.0 39 36.50275 38.0 38.0 38.0 34.0 38.0 40 36.5105 38.0 38.0 38.0 34.0 38.0 41 36.55925 38.0 38.0 38.0 34.0 38.0 42 36.62625 38.0 38.0 38.0 34.0 38.0 43 36.53075 38.0 38.0 38.0 34.0 38.0 44 36.52925 38.0 38.0 38.0 34.0 38.0 45 36.53775 38.0 38.0 38.0 34.0 38.0 46 36.48975 38.0 38.0 38.0 34.0 38.0 47 36.452 38.0 38.0 38.0 34.0 38.0 48 36.36675 38.0 38.0 38.0 34.0 38.0 49 36.335 38.0 38.0 38.0 34.0 38.0 50 36.22675 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 0.0 22 3.0 23 5.0 24 4.0 25 13.0 26 25.0 27 26.0 28 33.0 29 45.0 30 55.0 31 87.0 32 97.0 33 128.0 34 177.0 35 248.0 36 550.0 37 2497.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.483120780195044 14.678669667416855 8.177044261065266 44.66116529132283 2 22.975 21.65 36.6 18.775 3 21.475 24.8 24.55 29.175 4 23.3 32.375 19.475 24.85 5 23.175 33.675 22.675 20.474999999999998 6 19.725 31.7 22.75 25.825 7 16.150000000000002 17.75 40.0 26.1 8 22.025 19.975 27.075 30.925000000000004 9 20.3 19.7 31.125000000000004 28.875 10 23.0 33.650000000000006 21.2 22.15 11 26.700000000000003 21.975 19.0 32.324999999999996 12 26.0 18.5 24.7 30.8 13 21.675 24.625 25.825 27.875 14 23.275000000000002 26.150000000000002 25.324999999999996 25.25 15 23.75 25.2 25.374999999999996 25.674999999999997 16 23.275000000000002 25.15 24.45 27.125 17 23.474999999999998 25.0 26.275 25.25 18 22.275 24.9 25.825 27.0 19 23.075000000000003 26.900000000000002 23.75 26.275 20 24.85 24.775 25.35 25.025 21 23.35 26.424999999999997 24.9 25.324999999999996 22 23.125 26.0 26.125 24.75 23 23.400000000000002 26.1 25.35 25.15 24 23.1 25.224999999999998 26.325 25.35 25 23.45 25.35 25.05 26.150000000000002 26 23.025000000000002 26.950000000000003 24.349999999999998 25.674999999999997 27 23.724999999999998 25.900000000000002 26.575 23.799999999999997 28 23.075000000000003 24.975 25.650000000000002 26.3 29 23.825 26.424999999999997 24.275 25.474999999999998 30 23.9 23.925 26.450000000000003 25.724999999999998 31 22.8 25.25 24.425 27.525 32 23.275000000000002 26.400000000000002 25.275 25.05 33 21.349999999999998 26.075 25.05 27.525 34 23.9 26.05 25.025 25.025 35 24.625 25.224999999999998 25.3 24.85 36 23.35 25.324999999999996 25.424999999999997 25.900000000000002 37 23.65 25.85 24.7 25.8 38 23.5 25.924999999999997 24.2 26.375 39 22.525000000000002 25.85 25.924999999999997 25.7 40 24.25 24.7 24.9 26.150000000000002 41 22.6 26.3 25.575 25.525 42 22.775000000000002 24.15 25.8 27.275 43 22.8 25.424999999999997 25.224999999999998 26.55 44 24.099999999999998 26.075 25.4 24.425 45 22.825 25.25 25.474999999999998 26.450000000000003 46 23.5 26.400000000000002 24.625 25.474999999999998 47 23.3 26.075 25.124999999999996 25.5 48 22.125 25.174999999999997 25.674999999999997 27.025 49 23.05 25.974999999999998 25.124999999999996 25.85 50 23.3 26.05 25.624999999999996 25.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 6.5 26 10.0 27 14.0 28 18.0 29 19.5 30 21.0 31 40.0 32 59.0 33 74.5 34 90.0 35 103.5 36 117.0 37 143.0 38 169.0 39 201.5 40 234.0 41 262.5 42 291.0 43 306.0 44 321.0 45 340.0 46 359.0 47 339.5 48 320.0 49 325.5 50 331.0 51 336.0 52 341.0 53 297.5 54 254.0 55 251.0 56 248.0 57 224.0 58 200.0 59 175.5 60 151.0 61 133.0 62 115.0 63 96.5 64 78.0 65 75.0 66 72.0 67 62.0 68 52.0 69 49.5 70 47.0 71 44.0 72 41.0 73 32.0 74 23.0 75 20.5 76 18.0 77 12.5 78 7.0 79 4.0 80 1.0 81 3.0 82 5.0 83 3.5 84 2.0 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75666074600356 97.3 2 1.0403450900786604 2.0500000000000003 3 0.17761989342806395 0.525 4 0.0 0.0 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81234 spots for SRR6322399.sra Written 81234 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra Read 81228 spots for SRR6322399.sra Written 81228 spots for SRR6322399.sra SRR ids: ['SRR6322399.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ob2hhla6 SRR6322399.sra spots: 1624566 blocks: [[1, 81228], [81229, 162456], [162457, 243684], [243685, 324912], [324913, 406140], [406141, 487368], [487369, 568596], [568597, 649824], [649825, 731052], [731053, 812280], [812281, 893508], [893509, 974736], [974737, 1055964], [1055965, 1137192], [1137193, 1218420], [1218421, 1299648], [1299649, 1380876], [1380877, 1462104], [1462105, 1543332], [1543333, 1624566]] SRR6322399 file size 280498 SRR6322399 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322399 SRR6322399_1.fastq Input file: SRR6322399_1.fastq trimmed: SRR6322399-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:23:28 2024 >> started Sat Dec 7 10:23:29 2024 >> done (1.165s) 1624566 reads processed; of these: 467 ( 0.03%) short reads filtered out after trimming by size control 703 ( 0.04%) empty reads filtered out after trimming by size control 1623396 (99.93%) reads available; of these: 28518 ( 1.76%) trimmed reads available after processing 1594878 (98.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 42 0.00% 20 34 0.00% 21 37 0.00% 22 40 0.00% 23 41 0.00% 24 59 0.00% 25 90 0.01% 26 96 0.01% 27 104 0.01% 28 134 0.01% 29 196 0.01% 30 1234 0.08% 31 678 0.04% 32 419 0.03% 33 358 0.02% 34 373 0.02% 35 375 0.02% 36 454 0.03% 37 445 0.03% 38 479 0.03% 39 540 0.03% 40 644 0.04% 41 727 0.04% 42 890 0.05% 43 1112 0.07% 44 1390 0.09% 45 1716 0.11% 46 2192 0.14% 47 3022 0.19% 48 4478 0.28% 49 6096 0.38% 50 1594878 98.24% 1623396 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=7.58 fanout-score-rank=8 prefix-density=0.07 prefix-fanout=4.9 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=24.30 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.3 sequence=CTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTCGCGACGTCGGCGGCGGCGAACCGCCCCCGTCGCCGCGATCCGAACACTT Started job on | Dec 07 10:23:40 Started mapping on | Dec 07 10:23:40 Finished on | Dec 07 10:23:44 Mapping speed, Million of reads per hour | 1461.06 Number of input reads | 1623396 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 1476096 Uniquely mapped reads % | 90.93% Average mapped length | 49.80 Number of splices: Total | 234038 Number of splices: Annotated (sjdb) | 225695 Number of splices: GT/AG | 230959 Number of splices: GC/AG | 2569 Number of splices: AT/AC | 177 Number of splices: Non-canonical | 333 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 54790 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 81193 % of reads mapped to too many loci | 5.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 92510 92510 92510 N_multimapping 54790 54790 54790 N_noFeature 66774 1446636 76576 N_ambiguous 21119 97 1482 UnstrandedReadsAssigned:1388203 PositiveStrandReadsAssigned:29363 NegativeStrandReadsAssigned:1398038 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322399 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322399-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,623,396 reads, 1,400,939 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52973 SRR6322399.ke.tsv 35125 SRR6322399.se.tsv 88098 total ==> SRR6322399.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 21 31.298 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 0 0 KQK14071 474 375 0 0 ==> SRR6322399.se.tsv <== BRADI_1g14170v3 0 BRADI_1g53295v3 0 BRADI_1g59795v3 28 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 346 BRADI_1g74790v3 0 BRADI_1g09890v3 0 BRADI_1g77505v3 4 BRADI_1g48960v3 0 SRR6322399 completed mapping pipeline successfully