Starting /dee2/code/volunteer_pipeline.sh SRR6322400 current disk space = 1543652892672 free memory = 1601612404 SRR6322400 SRAfilesize a8cee122013af29ad2a2fdbc15a79472 SRR6322400.sra SRR6322400.sra file validated SRR6322400 is single end SRR6322400 is conventional basespace SRR6322400 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322400_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.186 33.0 33.0 34.0 31.0 34.0 2 32.47675 34.0 33.0 34.0 31.0 34.0 3 32.57175 34.0 33.0 34.0 31.0 34.0 4 32.468 34.0 33.0 34.0 31.0 34.0 5 32.48325 34.0 33.0 34.0 31.0 34.0 6 36.0855 38.0 36.0 38.0 31.0 38.0 7 36.57825 38.0 37.0 38.0 34.0 38.0 8 36.60975 38.0 38.0 38.0 34.0 38.0 9 36.675 38.0 38.0 38.0 34.0 38.0 10 36.75425 38.0 38.0 38.0 35.0 38.0 11 36.864 38.0 38.0 38.0 35.0 38.0 12 36.90675 38.0 38.0 38.0 35.0 38.0 13 36.81725 38.0 38.0 38.0 35.0 38.0 14 36.8335 38.0 38.0 38.0 35.0 38.0 15 36.65975 38.0 38.0 38.0 34.0 38.0 16 36.66425 38.0 38.0 38.0 34.0 38.0 17 36.71425 38.0 38.0 38.0 34.0 38.0 18 36.7925 38.0 38.0 38.0 35.0 38.0 19 36.79925 38.0 38.0 38.0 35.0 38.0 20 36.63825 38.0 38.0 38.0 34.0 38.0 21 36.62225 38.0 38.0 38.0 34.0 38.0 22 36.5845 38.0 38.0 38.0 34.0 38.0 23 36.51025 38.0 38.0 38.0 34.0 38.0 24 36.65925 38.0 38.0 38.0 34.0 38.0 25 36.60325 38.0 38.0 38.0 34.0 38.0 26 36.6825 38.0 38.0 38.0 34.0 38.0 27 36.65875 38.0 38.0 38.0 34.0 38.0 28 36.5155 38.0 38.0 38.0 34.0 38.0 29 36.67275 38.0 38.0 38.0 35.0 38.0 30 36.71375 38.0 38.0 38.0 34.0 38.0 31 36.7225 38.0 38.0 38.0 34.0 38.0 32 36.668 38.0 38.0 38.0 34.0 38.0 33 36.734 38.0 38.0 38.0 34.0 38.0 34 36.79125 38.0 38.0 38.0 35.0 38.0 35 36.706 38.0 38.0 38.0 34.0 38.0 36 36.6265 38.0 38.0 38.0 34.0 38.0 37 36.55975 38.0 38.0 38.0 34.0 38.0 38 36.591 38.0 38.0 38.0 34.0 38.0 39 36.65625 38.0 38.0 38.0 34.0 38.0 40 36.70025 38.0 38.0 38.0 34.0 38.0 41 36.61575 38.0 38.0 38.0 34.0 38.0 42 36.58425 38.0 38.0 38.0 34.0 38.0 43 36.55725 38.0 38.0 38.0 34.0 38.0 44 36.59575 38.0 38.0 38.0 34.0 38.0 45 36.42475 38.0 38.0 38.0 34.0 38.0 46 36.39875 38.0 38.0 38.0 34.0 38.0 47 36.34225 38.0 38.0 38.0 34.0 38.0 48 36.406 38.0 38.0 38.0 34.0 38.0 49 36.431 38.0 38.0 38.0 34.0 38.0 50 36.36925 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 3.0 22 4.0 23 1.0 24 6.0 25 8.0 26 24.0 27 29.0 28 34.0 29 54.0 30 54.0 31 75.0 32 106.0 33 121.0 34 175.0 35 259.0 36 528.0 37 2513.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.34190620272315 15.557236510337871 8.724155320221886 41.37670196671709 2 22.8 22.725 36.0 18.475 3 20.775 25.874999999999996 25.4 27.950000000000003 4 24.099999999999998 32.175 19.55 24.175 5 23.1 35.35 21.325 20.225 6 19.425 33.35 22.975 24.25 7 17.8 16.85 39.85 25.5 8 20.200000000000003 19.975 27.275 32.550000000000004 9 18.8 19.05 32.65 29.5 10 22.7 34.375 20.7 22.225 11 27.700000000000003 21.275 18.775 32.25 12 26.25 18.0 24.325 31.424999999999997 13 20.974999999999998 25.4 26.5 27.125 14 22.650000000000002 24.975 26.8 25.575 15 23.025000000000002 25.05 26.0 25.924999999999997 16 24.275 25.05 24.5 26.174999999999997 17 23.225 25.5 26.125 25.15 18 24.356089022255563 26.281570392598148 25.006251562890725 24.356089022255563 19 22.95 26.375 25.025 25.650000000000002 20 22.45 27.425 25.324999999999996 24.8 21 21.975 27.375 25.3 25.35 22 22.775000000000002 26.400000000000002 24.5 26.325 23 21.875 26.775 25.0 26.35 24 23.375 25.35 26.875 24.4 25 23.175 26.450000000000003 24.575 25.8 26 21.85 27.725 25.275 25.15 27 22.95573893473368 25.206301575393848 26.30657664416104 25.531382845711427 28 21.349999999999998 25.900000000000002 25.474999999999998 27.275 29 22.725 26.700000000000003 26.400000000000002 24.175 30 21.65 25.85 27.800000000000004 24.7 31 22.650000000000002 25.025 24.625 27.700000000000003 32 21.875 27.425 26.5 24.2 33 21.0 25.775 27.425 25.8 34 22.125 26.325 25.4 26.150000000000002 35 22.275 26.0 25.575 26.150000000000002 36 23.775 26.174999999999997 24.825 25.224999999999998 37 22.45 25.45 26.125 25.974999999999998 38 23.125 26.974999999999998 25.324999999999996 24.575 39 22.3 25.35 26.424999999999997 25.924999999999997 40 23.425 25.95 24.15 26.474999999999998 41 22.225 26.85 25.224999999999998 25.7 42 21.625 25.324999999999996 27.075 25.974999999999998 43 23.45 25.5 26.400000000000002 24.65 44 22.8 26.200000000000003 26.375 24.625 45 23.549999999999997 25.25 25.7 25.5 46 22.650000000000002 25.174999999999997 26.174999999999997 26.0 47 21.125 25.900000000000002 27.3 25.674999999999997 48 21.349999999999998 26.025 26.424999999999997 26.200000000000003 49 23.175 25.724999999999998 24.425 26.674999999999997 50 22.35 26.125 25.900000000000002 25.624999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 4.5 24 6.0 25 4.5 26 3.0 27 13.0 28 23.0 29 21.5 30 20.0 31 41.5 32 63.0 33 72.5 34 82.0 35 119.0 36 156.0 37 182.0 38 208.0 39 227.5 40 247.0 41 277.5 42 308.0 43 324.5 44 341.0 45 338.5 46 336.0 47 337.0 48 338.0 49 361.5 50 385.0 51 347.5 52 310.0 53 277.0 54 244.0 55 223.0 56 202.0 57 199.0 58 196.0 59 160.0 60 124.0 61 108.5 62 93.0 63 85.0 64 77.0 65 74.0 66 71.0 67 62.5 68 54.0 69 44.0 70 34.0 71 30.0 72 26.0 73 20.0 74 14.0 75 14.5 76 15.0 77 13.5 78 12.0 79 9.5 80 7.0 81 4.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.025 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98580121703854 97.6 2 0.8113590263691683 1.6 3 0.07606490872210953 0.22499999999999998 4 0.07606490872210953 0.3 5 0.02535496957403651 0.125 6 0.02535496957403651 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 6 0.15 TruSeq Adapter, Index 2 (100% over 50bp) GTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241203 spots for SRR6322400.sra Written 1241203 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra Read 1241194 spots for SRR6322400.sra Written 1241194 spots for SRR6322400.sra SRR ids: ['SRR6322400.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9kvtlc7u SRR6322400.sra spots: 24823889 blocks: [[1, 1241194], [1241195, 2482388], [2482389, 3723582], [3723583, 4964776], [4964777, 6205970], [6205971, 7447164], [7447165, 8688358], [8688359, 9929552], [9929553, 11170746], [11170747, 12411940], [12411941, 13653134], [13653135, 14894328], [14894329, 16135522], [16135523, 17376716], [17376717, 18617910], [18617911, 19859104], [19859105, 21100298], [21100299, 22341492], [22341493, 23582686], [23582687, 24823889]] SRR6322400 file size 4316074 SRR6322400 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322400 SRR6322400_1.fastq Input file: SRR6322400_1.fastq trimmed: SRR6322400-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:23:02 2024 >> started Sat Dec 7 10:23:11 2024 >> done (9.473s) 24823889 reads processed; of these: 7077 ( 0.03%) short reads filtered out after trimming by size control 21563 ( 0.09%) empty reads filtered out after trimming by size control 24795249 (99.88%) reads available; of these: 393726 ( 1.59%) trimmed reads available after processing 24401523 (98.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 403 0.00% 19 366 0.00% 20 390 0.00% 21 434 0.00% 22 560 0.00% 23 693 0.00% 24 816 0.00% 25 1111 0.00% 26 1139 0.00% 27 1275 0.01% 28 1731 0.01% 29 2493 0.01% 30 13433 0.05% 31 6979 0.03% 32 5048 0.02% 33 4712 0.02% 34 4733 0.02% 35 5050 0.02% 36 5520 0.02% 37 6035 0.02% 38 6779 0.03% 39 7720 0.03% 40 8922 0.04% 41 10438 0.04% 42 12524 0.05% 43 15607 0.06% 44 19296 0.08% 45 23320 0.09% 46 30773 0.12% 47 43631 0.18% 48 64127 0.26% 49 87668 0.35% 50 24401523 98.41% 24795249 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=7.14 fanout-score-rank=12 prefix-density=0.07 prefix-fanout=5.5 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=358.30 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=11.8 sequence=TTCTTCTTGCGGCAGTTGACAGCCCTGGGATGCAGGCGTGCATAGCATTTGCGGCAGATCATCTTCTCCTGGTTGTACTTGCGG Started job on | Dec 07 10:23:23 Started mapping on | Dec 07 10:23:23 Finished on | Dec 07 10:23:47 Mapping speed, Million of reads per hour | 3719.29 Number of input reads | 24795249 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 22488557 Uniquely mapped reads % | 90.70% Average mapped length | 49.82 Number of splices: Total | 3695207 Number of splices: Annotated (sjdb) | 3564411 Number of splices: GT/AG | 3645981 Number of splices: GC/AG | 41996 Number of splices: AT/AC | 2452 Number of splices: Non-canonical | 4778 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 943122 % of reads mapped to multiple loci | 3.80% Number of reads mapped to too many loci | 1217076 % of reads mapped to too many loci | 4.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1363570 1363570 1363570 N_multimapping 943122 943122 943122 N_noFeature 1163485 22048876 1318446 N_ambiguous 307206 1694 22606 UnstrandedReadsAssigned:21017866 PositiveStrandReadsAssigned:437987 NegativeStrandReadsAssigned:21147505 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322400 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322400-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,795,249 reads, 21,295,250 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6322400.ke.tsv 35125 SRR6322400.se.tsv 88098 total ==> SRR6322400.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 171.708 16.6234 PNS24247 1044 945 21.6083 1.85287 PNS24249 1928 1829 35.4384 1.57006 PNS24246 1044 945 21.6083 1.85287 PNS24248 1044 945 21.6083 1.85287 PNS24244 1471 1372 183.029 10.8099 PNS24243 293 194 0 0 KQK14069 1603 1504 3.48393 0.187706 KQK14071 474 375 0.131335 0.0283795 ==> SRR6322400.se.tsv <== BRADI_1g14170v3 12 BRADI_1g53295v3 30 BRADI_1g59795v3 668 BRADI_1g07683v3 0 BRADI_1g00485v3 181 BRADI_1g20270v3 2740 BRADI_1g74790v3 3 BRADI_1g09890v3 0 BRADI_1g77505v3 335 BRADI_1g48960v3 2 SRR6322400 completed mapping pipeline successfully