Starting /dee2/code/volunteer_pipeline.sh SRR6322401 current disk space = 1543032627200 free memory = 1600091972 SRR6322401 SRAfilesize 30ff3d2025dad80962ec4bf111147223 SRR6322401.sra SRR6322401.sra file validated SRR6322401 is single end SRR6322401 is conventional basespace SRR6322401 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322401_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22475 33.0 33.0 34.0 31.0 34.0 2 32.414 33.0 33.0 34.0 30.0 34.0 3 32.4735 33.0 33.0 34.0 31.0 34.0 4 32.39 33.0 33.0 34.0 31.0 34.0 5 32.384 33.0 33.0 34.0 31.0 34.0 6 36.0005 38.0 36.0 38.0 31.0 38.0 7 36.444 38.0 37.0 38.0 33.0 38.0 8 36.54675 38.0 38.0 38.0 34.0 38.0 9 36.544 38.0 38.0 38.0 34.0 38.0 10 36.73325 38.0 38.0 38.0 34.0 38.0 11 36.745 38.0 38.0 38.0 34.0 38.0 12 36.7535 38.0 38.0 38.0 34.0 38.0 13 36.728 38.0 38.0 38.0 34.0 38.0 14 36.72625 38.0 38.0 38.0 34.0 38.0 15 36.61825 38.0 38.0 38.0 34.0 38.0 16 36.67125 38.0 38.0 38.0 34.0 38.0 17 36.785 38.0 38.0 38.0 34.0 38.0 18 36.716 38.0 38.0 38.0 34.0 38.0 19 36.649 38.0 38.0 38.0 34.0 38.0 20 36.54925 38.0 38.0 38.0 34.0 38.0 21 36.75675 38.0 38.0 38.0 34.0 38.0 22 36.52475 38.0 38.0 38.0 34.0 38.0 23 36.419 38.0 38.0 38.0 34.0 38.0 24 36.5065 38.0 38.0 38.0 34.0 38.0 25 36.41825 38.0 38.0 38.0 33.0 38.0 26 36.6165 38.0 38.0 38.0 34.0 38.0 27 36.5985 38.0 38.0 38.0 34.0 38.0 28 36.48475 38.0 38.0 38.0 34.0 38.0 29 36.687 38.0 38.0 38.0 34.0 38.0 30 36.719 38.0 38.0 38.0 34.0 38.0 31 36.58575 38.0 38.0 38.0 34.0 38.0 32 36.61625 38.0 38.0 38.0 34.0 38.0 33 36.66325 38.0 38.0 38.0 34.0 38.0 34 36.653 38.0 38.0 38.0 34.0 38.0 35 36.52525 38.0 38.0 38.0 34.0 38.0 36 36.58175 38.0 38.0 38.0 34.0 38.0 37 36.4925 38.0 38.0 38.0 34.0 38.0 38 36.576 38.0 38.0 38.0 34.0 38.0 39 36.47925 38.0 38.0 38.0 34.0 38.0 40 36.532 38.0 38.0 38.0 34.0 38.0 41 36.4915 38.0 38.0 38.0 34.0 38.0 42 36.455 38.0 38.0 38.0 34.0 38.0 43 36.4615 38.0 38.0 38.0 34.0 38.0 44 36.52025 38.0 38.0 38.0 34.0 38.0 45 36.41475 38.0 38.0 38.0 34.0 38.0 46 36.216 38.0 38.0 38.0 33.0 38.0 47 36.114 38.0 38.0 38.0 33.0 38.0 48 36.34775 38.0 38.0 38.0 34.0 38.0 49 36.1545 38.0 38.0 38.0 34.0 38.0 50 36.235 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 2.0 22 2.0 23 5.0 24 10.0 25 10.0 26 15.0 27 25.0 28 38.0 29 58.0 30 63.0 31 83.0 32 109.0 33 128.0 34 186.0 35 282.0 36 543.0 37 2433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.02625599596062 12.774551880838173 7.14466043928301 44.0545316839182 2 23.674999999999997 22.15 35.175 19.0 3 21.15 24.349999999999998 21.775 32.725 4 26.450000000000003 31.974999999999998 18.45 23.125 5 23.93098274568642 33.73343335833959 21.555388847211805 20.78019504876219 6 20.0 31.8 21.875 26.325 7 18.925 16.75 37.15 27.175 8 21.175 19.15 26.875 32.800000000000004 9 21.75 18.224999999999998 29.599999999999998 30.425 10 24.625 31.624999999999996 20.674999999999997 23.075000000000003 11 29.725 19.3 19.0 31.974999999999998 12 29.049999999999997 16.675 21.2 33.074999999999996 13 23.525 22.675 24.95 28.849999999999998 14 24.075 25.7 25.85 24.375 15 24.775 23.549999999999997 24.75 26.924999999999997 16 23.849999999999998 23.325000000000003 24.325 28.499999999999996 17 25.1 24.325 23.175 27.400000000000002 18 23.755938984746187 24.58114528632158 24.456114028507127 27.206801700425103 19 24.2 24.6 24.325 26.875 20 24.7 24.075 23.95 27.275 21 24.25 23.400000000000002 24.7 27.650000000000002 22 24.775 25.6 23.35 26.275 23 24.725 24.025 25.525 25.724999999999998 24 24.0 24.575 24.2 27.224999999999998 25 24.9 23.3 24.975 26.825 26 24.25 24.875 25.35 25.525 27 23.53088272068017 23.53088272068017 24.131032758189548 28.80720180045011 28 24.474999999999998 24.224999999999998 23.849999999999998 27.450000000000003 29 25.474999999999998 24.349999999999998 24.125 26.05 30 24.025 24.825 24.0 27.150000000000002 31 24.3 25.224999999999998 23.225 27.250000000000004 32 24.55 25.7 24.275 25.474999999999998 33 24.9 23.150000000000002 24.275 27.675 34 25.124999999999996 23.45 24.725 26.700000000000003 35 24.75 24.8 24.075 26.375 36 24.15 23.75 24.2 27.900000000000002 37 24.175 25.2 24.099999999999998 26.525 38 25.4 25.224999999999998 23.225 26.150000000000002 39 25.025 22.925 25.224999999999998 26.825 40 24.925 23.125 24.425 27.525 41 24.6 23.875 24.825 26.700000000000003 42 25.1 23.95 24.575 26.375 43 24.625 23.400000000000002 24.875 27.1 44 25.025 24.4 23.849999999999998 26.724999999999998 45 24.15 24.5 24.575 26.775 46 25.025 23.65 24.075 27.250000000000004 47 24.85 25.25 24.75 25.15 48 24.325 23.35 25.0 27.325 49 25.124999999999996 23.525 24.125 27.224999999999998 50 24.275 23.7 25.7 26.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 3.0 24 2.0 25 4.0 26 6.0 27 9.5 28 13.0 29 22.5 30 32.0 31 38.0 32 44.0 33 66.0 34 88.0 35 98.0 36 108.0 37 134.5 38 161.0 39 178.5 40 196.0 41 215.0 42 234.0 43 255.0 44 276.0 45 281.0 46 286.0 47 297.0 48 308.0 49 302.0 50 296.0 51 283.0 52 270.0 53 265.5 54 261.0 55 230.5 56 200.0 57 193.5 58 187.0 59 187.0 60 187.0 61 167.5 62 148.0 63 142.5 64 137.0 65 127.5 66 118.0 67 106.5 68 95.0 69 92.0 70 89.0 71 81.0 72 73.0 73 67.0 74 61.0 75 58.0 76 55.0 77 39.0 78 23.0 79 24.0 80 25.0 81 18.0 82 11.0 83 7.0 84 3.0 85 2.5 86 2.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.025 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.2 #Duplication Level Percentage of deduplicated Percentage of total 1 97.91666666666666 95.175 2 1.7746913580246912 3.45 3 0.15432098765432098 0.44999999999999996 4 0.0257201646090535 0.1 5 0.07716049382716049 0.375 6 0.0 0.0 7 0.0257201646090535 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0257201646090535 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGAC 11 0.27499999999999997 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 14 (97% over 44bp) CGCCGCCCGTGGGGAAGGGAGCTTCGAGGCGGCCGGACGCGGCTCGTCGG 5 0.125 No Hit GTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTTGATTTC 5 0.125 No Hit CAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210400 spots for SRR6322401.sra Written 1210400 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra Read 1210383 spots for SRR6322401.sra Written 1210383 spots for SRR6322401.sra SRR ids: ['SRR6322401.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2q_g01d_ SRR6322401.sra spots: 24207677 blocks: [[1, 1210383], [1210384, 2420766], [2420767, 3631149], [3631150, 4841532], [4841533, 6051915], [6051916, 7262298], [7262299, 8472681], [8472682, 9683064], [9683065, 10893447], [10893448, 12103830], [12103831, 13314213], [13314214, 14524596], [14524597, 15734979], [15734980, 16945362], [16945363, 18155745], [18155746, 19366128], [19366129, 20576511], [20576512, 21786894], [21786895, 22997277], [22997278, 24207677]] SRR6322401 file size 4208664 SRR6322401 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322401 SRR6322401_1.fastq Input file: SRR6322401_1.fastq trimmed: SRR6322401-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:03:10 2024 >> started Sat Dec 7 12:03:27 2024 >> done (17.317s) 24207677 reads processed; of these: 5030 ( 0.02%) short reads filtered out after trimming by size control 27865 ( 0.12%) empty reads filtered out after trimming by size control 24174782 (99.86%) reads available; of these: 540508 ( 2.24%) trimmed reads available after processing 23634274 (97.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 479 0.00% 19 494 0.00% 20 646 0.00% 21 690 0.00% 22 791 0.00% 23 976 0.00% 24 1217 0.01% 25 1664 0.01% 26 1787 0.01% 27 1960 0.01% 28 2352 0.01% 29 3518 0.01% 30 18473 0.08% 31 9619 0.04% 32 6756 0.03% 33 6581 0.03% 34 6266 0.03% 35 6620 0.03% 36 7284 0.03% 37 7888 0.03% 38 8723 0.04% 39 10310 0.04% 40 11665 0.05% 41 13701 0.06% 42 16379 0.07% 43 20532 0.08% 44 24975 0.10% 45 31313 0.13% 46 41415 0.17% 47 58396 0.24% 48 89902 0.37% 49 127136 0.53% 50 23634274 97.76% 24174782 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=23 prefix-density=0.13 prefix-fanout=2.0 sequence=CAGGGACAGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=4 fanout-score=45.48 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=8.2 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCGGTTGATCAAAAGCTCGAGGAGCTA Started job on | Dec 07 12:03:40 Started mapping on | Dec 07 12:03:40 Finished on | Dec 07 12:04:13 Mapping speed, Million of reads per hour | 2637.25 Number of input reads | 24174782 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 21339522 Uniquely mapped reads % | 88.27% Average mapped length | 49.78 Number of splices: Total | 2962802 Number of splices: Annotated (sjdb) | 2851829 Number of splices: GT/AG | 2922472 Number of splices: GC/AG | 33952 Number of splices: AT/AC | 1372 Number of splices: Non-canonical | 5006 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 564442 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 2139051 % of reads mapped to too many loci | 8.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.42% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2270818 2270818 2270818 N_multimapping 564442 564442 564442 N_noFeature 969727 20848790 1161942 N_ambiguous 317385 1471 19420 UnstrandedReadsAssigned:20052410 PositiveStrandReadsAssigned:489261 NegativeStrandReadsAssigned:20158160 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322401 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322401-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,174,782 reads, 19,908,791 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR6322401.ke.tsv 35125 SRR6322401.se.tsv 88098 total ==> SRR6322401.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 48.0205 5.03635 PNS24247 1044 945 9.7896 0.909385 PNS24249 1928 1829 86.5384 4.15346 PNS24246 1044 945 9.7896 0.909385 PNS24248 1044 945 9.7896 0.909385 PNS24244 1471 1372 12.0723 0.772415 PNS24243 293 194 0 0 KQK14069 1603 1504 0 0 KQK14071 474 375 0 0 ==> SRR6322401.se.tsv <== BRADI_1g14170v3 1 BRADI_1g53295v3 46 BRADI_1g59795v3 232 BRADI_1g07683v3 0 BRADI_1g00485v3 117 BRADI_1g20270v3 517 BRADI_1g74790v3 175 BRADI_1g09890v3 32 BRADI_1g77505v3 260 BRADI_1g48960v3 0 SRR6322401 completed mapping pipeline successfully