Starting /dee2/code/volunteer_pipeline.sh SRR6322402 current disk space = 1543030632448 free memory = 1603112316 SRR6322402 SRAfilesize 3cbe2fd46ae5fd79d4ab8450a30be40e SRR6322402.sra SRR6322402.sra file validated SRR6322402 is single end SRR6322402 is conventional basespace SRR6322402 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322402_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0595 33.0 33.0 34.0 30.0 34.0 2 32.2835 33.0 33.0 34.0 30.0 34.0 3 32.328 33.0 33.0 34.0 30.0 34.0 4 32.367 33.0 33.0 34.0 31.0 34.0 5 32.3235 33.0 33.0 34.0 31.0 34.0 6 35.92575 38.0 36.0 38.0 31.0 38.0 7 36.4405 38.0 37.0 38.0 34.0 38.0 8 36.40225 38.0 38.0 38.0 34.0 38.0 9 36.50025 38.0 38.0 38.0 34.0 38.0 10 36.59775 38.0 38.0 38.0 34.0 38.0 11 36.698 38.0 38.0 38.0 34.0 38.0 12 36.688 38.0 38.0 38.0 34.0 38.0 13 36.69475 38.0 38.0 38.0 34.0 38.0 14 36.61425 38.0 38.0 38.0 34.0 38.0 15 36.603 38.0 38.0 38.0 34.0 38.0 16 36.5345 38.0 38.0 38.0 34.0 38.0 17 36.672 38.0 38.0 38.0 34.0 38.0 18 36.699 38.0 38.0 38.0 34.0 38.0 19 36.558 38.0 38.0 38.0 34.0 38.0 20 36.54525 38.0 38.0 38.0 34.0 38.0 21 36.5575 38.0 38.0 38.0 34.0 38.0 22 36.5245 38.0 38.0 38.0 34.0 38.0 23 36.44925 38.0 38.0 38.0 34.0 38.0 24 36.48625 38.0 38.0 38.0 34.0 38.0 25 36.38375 38.0 38.0 38.0 33.0 38.0 26 36.59575 38.0 38.0 38.0 34.0 38.0 27 36.4775 38.0 38.0 38.0 34.0 38.0 28 36.46325 38.0 38.0 38.0 34.0 38.0 29 36.5535 38.0 38.0 38.0 34.0 38.0 30 36.594 38.0 38.0 38.0 34.0 38.0 31 36.62775 38.0 38.0 38.0 34.0 38.0 32 36.64425 38.0 38.0 38.0 34.0 38.0 33 36.675 38.0 38.0 38.0 35.0 38.0 34 36.50625 38.0 38.0 38.0 34.0 38.0 35 36.5875 38.0 38.0 38.0 34.0 38.0 36 36.478 38.0 38.0 38.0 34.0 38.0 37 36.5035 38.0 38.0 38.0 34.0 38.0 38 36.51975 38.0 38.0 38.0 34.0 38.0 39 36.56075 38.0 38.0 38.0 34.0 38.0 40 36.49275 38.0 38.0 38.0 34.0 38.0 41 36.50375 38.0 38.0 38.0 34.0 38.0 42 36.496 38.0 38.0 38.0 34.0 38.0 43 36.4875 38.0 38.0 38.0 34.0 38.0 44 36.40975 38.0 38.0 38.0 34.0 38.0 45 36.3965 38.0 38.0 38.0 34.0 38.0 46 36.301 38.0 38.0 38.0 34.0 38.0 47 36.3415 38.0 38.0 38.0 34.0 38.0 48 36.212 38.0 38.0 38.0 34.0 38.0 49 36.19125 38.0 38.0 38.0 34.0 38.0 50 36.18525 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 2.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 2.0 23 5.0 24 6.0 25 10.0 26 14.0 27 26.0 28 38.0 29 45.0 30 65.0 31 80.0 32 116.0 33 121.0 34 193.0 35 244.0 36 605.0 37 2410.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.312056737588655 12.25937183383992 10.815602836879433 35.612968591691995 2 27.025 20.625 29.325000000000003 23.025000000000002 3 25.45 22.275 21.325 30.95 4 28.825 29.675 17.375 24.125 5 27.66383191595798 30.09004502251126 20.23511755877939 22.011005502751377 6 24.675 29.2 21.325 24.8 7 19.1 18.099999999999998 37.8 25.0 8 25.525 20.225 23.150000000000002 31.1 9 24.0 17.525 27.750000000000004 30.725 10 26.674999999999997 31.55 18.8 22.975 11 31.900000000000002 18.575 17.150000000000002 32.375 12 28.175 15.9 20.875 35.05 13 24.575 23.525 22.625 29.275000000000002 14 24.8 23.1 24.625 27.474999999999998 15 25.55 24.85 23.275000000000002 26.325 16 25.650000000000002 22.675 23.175 28.499999999999996 17 26.525 22.925 24.0 26.55 18 25.406351587896975 22.980745186296573 24.48112028007002 27.131782945736433 19 25.474999999999998 24.625 22.525000000000002 27.375 20 25.900000000000002 22.6 24.875 26.625 21 26.575 22.0 23.799999999999997 27.625 22 25.55 24.55 21.925 27.975 23 25.374999999999996 24.75 23.799999999999997 26.075 24 26.025 23.0 22.425 28.549999999999997 25 25.324999999999996 22.650000000000002 24.575 27.450000000000003 26 25.8 23.35 22.7 28.15 27 24.706176544136035 23.78094523630908 22.50562640660165 29.00725181295324 28 26.924999999999997 23.724999999999998 22.875 26.474999999999998 29 26.75 23.599999999999998 23.9 25.75 30 26.424999999999997 22.35 26.075 25.15 31 26.0 22.400000000000002 22.625 28.975 32 25.25 25.374999999999996 23.175 26.200000000000003 33 24.75 23.1 23.0 29.15 34 25.924999999999997 25.674999999999997 22.525000000000002 25.874999999999996 35 28.1 23.175 23.0 25.724999999999998 36 24.525 22.675 24.525 28.275 37 25.85 22.175 23.05 28.925 38 26.450000000000003 24.75 23.175 25.624999999999996 39 25.275 23.799999999999997 22.400000000000002 28.525 40 25.724999999999998 23.200000000000003 23.25 27.825 41 25.575 24.975 23.65 25.8 42 24.875 24.45 22.7 27.975 43 26.025 23.225 24.05 26.700000000000003 44 25.5 23.1 24.0 27.400000000000002 45 25.5 22.425 24.875 27.200000000000003 46 25.900000000000002 22.475 23.05 28.575 47 29.175 23.175 22.925 24.725 48 25.775 22.8 24.3 27.125 49 26.825 24.325 21.45 27.400000000000002 50 25.5 23.599999999999998 24.675 26.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 1.0 21 1.0 22 1.0 23 1.5 24 2.0 25 4.0 26 6.0 27 12.5 28 19.0 29 23.0 30 27.0 31 35.0 32 43.0 33 55.0 34 67.0 35 79.5 36 92.0 37 117.0 38 142.0 39 151.5 40 161.0 41 174.5 42 188.0 43 207.0 44 226.0 45 230.0 46 234.0 47 288.5 48 343.0 49 306.0 50 269.0 51 257.0 52 245.0 53 245.0 54 245.0 55 236.5 56 228.0 57 213.0 58 198.0 59 176.0 60 154.0 61 163.0 62 172.0 63 160.5 64 149.0 65 153.0 66 157.0 67 143.0 68 129.0 69 131.0 70 133.0 71 124.5 72 116.0 73 100.0 74 84.0 75 71.5 76 59.0 77 54.5 78 50.0 79 36.5 80 23.0 81 21.0 82 19.0 83 14.5 84 10.0 85 6.5 86 3.0 87 2.5 88 2.0 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.025 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.89146687290538 95.89999999999999 2 0.9280742459396751 1.7999999999999998 3 0.10311936065996391 0.3 4 0.025779840164990978 0.1 5 0.025779840164990978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025779840164990978 1.775 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 71 1.775 TruSeq Adapter, Index 13 (97% over 40bp) GTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448805 spots for SRR6322402.sra Written 1448805 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra Read 1448793 spots for SRR6322402.sra Written 1448793 spots for SRR6322402.sra SRR ids: ['SRR6322402.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_edlhb0pl SRR6322402.sra spots: 28975872 blocks: [[1, 1448793], [1448794, 2897586], [2897587, 4346379], [4346380, 5795172], [5795173, 7243965], [7243966, 8692758], [8692759, 10141551], [10141552, 11590344], [11590345, 13039137], [13039138, 14487930], [14487931, 15936723], [15936724, 17385516], [17385517, 18834309], [18834310, 20283102], [20283103, 21731895], [21731896, 23180688], [23180689, 24629481], [24629482, 26078274], [26078275, 27527067], [27527068, 28975872]] SRR6322402 file size 5039771 SRR6322402 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322402 SRR6322402_1.fastq Input file: SRR6322402_1.fastq trimmed: SRR6322402-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:03:31 2024 >> started Sat Dec 7 12:03:51 2024 >> done (19.963s) 28975872 reads processed; of these: 9072 ( 0.03%) short reads filtered out after trimming by size control 513031 ( 1.77%) empty reads filtered out after trimming by size control 28453769 (98.20%) reads available; of these: 679263 ( 2.39%) trimmed reads available after processing 27774506 (97.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 713 0.00% 19 709 0.00% 20 878 0.00% 21 1002 0.00% 22 1173 0.00% 23 1351 0.00% 24 1740 0.01% 25 2119 0.01% 26 2279 0.01% 27 2453 0.01% 28 3116 0.01% 29 4806 0.02% 30 24280 0.09% 31 12487 0.04% 32 8889 0.03% 33 8311 0.03% 34 8218 0.03% 35 8520 0.03% 36 9277 0.03% 37 10058 0.04% 38 10791 0.04% 39 12728 0.04% 40 14281 0.05% 41 17338 0.06% 42 20573 0.07% 43 25674 0.09% 44 31231 0.11% 45 38883 0.14% 46 51163 0.18% 47 73181 0.26% 48 111834 0.39% 49 159207 0.56% 50 27774506 97.61% 28453769 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=24 prefix-density=0.14 prefix-fanout=2.6 sequence=GAGCTTGGCGGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=132.27 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=15.2 sequence=CGGCGGCGGCGG Started job on | Dec 07 12:04:12 Started mapping on | Dec 07 12:04:12 Finished on | Dec 07 12:04:37 Mapping speed, Million of reads per hour | 4097.34 Number of input reads | 28453769 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26547709 Uniquely mapped reads % | 93.30% Average mapped length | 49.77 Number of splices: Total | 3386224 Number of splices: Annotated (sjdb) | 3242853 Number of splices: GT/AG | 3339456 Number of splices: GC/AG | 37819 Number of splices: AT/AC | 1711 Number of splices: Non-canonical | 7238 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 546385 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 1162362 % of reads mapped to too many loci | 4.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1359675 1359675 1359675 N_multimapping 546385 546385 546385 N_noFeature 991827 25915422 1270878 N_ambiguous 374870 1775 22263 UnstrandedReadsAssigned:25181012 PositiveStrandReadsAssigned:630512 NegativeStrandReadsAssigned:25254568 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322402 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322402-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,453,769 reads, 24,896,806 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6322402.ke.tsv 35125 SRR6322402.se.tsv 88098 total ==> SRR6322402.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 68.1179 5.52683 PNS24247 1044 945 9.74284 0.700155 PNS24249 1928 1829 196.654 7.30178 PNS24246 1044 945 9.74284 0.700155 PNS24248 1044 945 9.74284 0.700155 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 2.00243 0.0904169 KQK14071 474 375 0 0 ==> SRR6322402.se.tsv <== BRADI_1g14170v3 2 BRADI_1g53295v3 38 BRADI_1g59795v3 240 BRADI_1g07683v3 0 BRADI_1g00485v3 232 BRADI_1g20270v3 698 BRADI_1g74790v3 199 BRADI_1g09890v3 49 BRADI_1g77505v3 293 BRADI_1g48960v3 0 SRR6322402 completed mapping pipeline successfully