Starting /dee2/code/volunteer_pipeline.sh SRR6322403 current disk space = 1543029002240 free memory = 1603109208 SRR6322403 SRAfilesize 2211287c41d22377fe0d2e14b6836237 SRR6322403.sra SRR6322403.sra file validated SRR6322403 is single end SRR6322403 is conventional basespace SRR6322403 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322403_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.036 33.0 33.0 34.0 31.0 34.0 2 32.40125 33.0 33.0 34.0 30.0 34.0 3 32.44275 33.0 33.0 34.0 31.0 34.0 4 32.34875 33.0 33.0 34.0 31.0 34.0 5 32.43125 33.0 33.0 34.0 31.0 34.0 6 35.9715 38.0 36.0 38.0 31.0 38.0 7 36.4905 38.0 37.0 38.0 34.0 38.0 8 36.60825 38.0 38.0 38.0 34.0 38.0 9 36.49925 38.0 38.0 38.0 34.0 38.0 10 36.66775 38.0 38.0 38.0 34.0 38.0 11 36.69175 38.0 38.0 38.0 34.0 38.0 12 36.65325 38.0 38.0 38.0 34.0 38.0 13 36.72475 38.0 38.0 38.0 34.0 38.0 14 36.595 38.0 38.0 38.0 34.0 38.0 15 36.598 38.0 38.0 38.0 34.0 38.0 16 36.5635 38.0 38.0 38.0 34.0 38.0 17 36.66925 38.0 38.0 38.0 34.0 38.0 18 36.7305 38.0 38.0 38.0 34.0 38.0 19 36.6035 38.0 38.0 38.0 34.0 38.0 20 36.528 38.0 38.0 38.0 34.0 38.0 21 36.5475 38.0 38.0 38.0 34.0 38.0 22 36.464 38.0 38.0 38.0 34.0 38.0 23 36.41125 38.0 38.0 38.0 33.0 38.0 24 36.609 38.0 38.0 38.0 34.0 38.0 25 36.56875 38.0 38.0 38.0 34.0 38.0 26 36.49375 38.0 38.0 38.0 34.0 38.0 27 36.587 38.0 38.0 38.0 34.0 38.0 28 36.52625 38.0 38.0 38.0 34.0 38.0 29 36.60675 38.0 38.0 38.0 34.0 38.0 30 36.56425 38.0 38.0 38.0 34.0 38.0 31 36.57475 38.0 38.0 38.0 34.0 38.0 32 36.5565 38.0 38.0 38.0 34.0 38.0 33 36.5215 38.0 38.0 38.0 34.0 38.0 34 36.55075 38.0 38.0 38.0 34.0 38.0 35 36.545 38.0 38.0 38.0 34.0 38.0 36 36.407 38.0 38.0 38.0 34.0 38.0 37 36.488 38.0 38.0 38.0 34.0 38.0 38 36.53875 38.0 38.0 38.0 34.0 38.0 39 36.49525 38.0 38.0 38.0 34.0 38.0 40 36.49125 38.0 38.0 38.0 34.0 38.0 41 36.47925 38.0 38.0 38.0 34.0 38.0 42 36.52075 38.0 38.0 38.0 34.0 38.0 43 36.47475 38.0 38.0 38.0 34.0 38.0 44 36.42325 38.0 38.0 38.0 34.0 38.0 45 36.28075 38.0 38.0 38.0 33.0 38.0 46 36.2175 38.0 38.0 38.0 33.0 38.0 47 36.16375 38.0 38.0 38.0 33.0 38.0 48 36.211 38.0 38.0 38.0 33.0 38.0 49 36.29675 38.0 38.0 38.0 34.0 38.0 50 36.10075 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 1.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 2.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 10.0 24 9.0 25 6.0 26 20.0 27 33.0 28 36.0 29 49.0 30 73.0 31 78.0 32 103.0 33 116.0 34 150.0 35 280.0 36 572.0 37 2445.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.42553191489361 12.8419452887538 10.714285714285714 36.01823708206687 2 25.275 21.475 30.825000000000003 22.425 3 22.75 24.5 23.925 28.825 4 28.249999999999996 30.525000000000002 17.599999999999998 23.625 5 27.481870467616904 29.957489372343087 20.855213803450862 21.705426356589147 6 23.0 30.725 21.5 24.775 7 19.475 17.925 37.875 24.725 8 23.400000000000002 21.375 23.7 31.525 9 23.974999999999998 18.3 28.925 28.799999999999997 10 24.55 33.900000000000006 20.0 21.55 11 30.875000000000004 18.925 17.625 32.574999999999996 12 27.425 17.1 22.225 33.25 13 24.05 24.275 24.525 27.150000000000002 14 22.55 25.275 24.925 27.250000000000004 15 24.0 25.174999999999997 24.474999999999998 26.35 16 24.55 22.1 24.075 29.275000000000002 17 26.0 24.725 23.375 25.900000000000002 18 24.875 23.25 26.0 25.874999999999996 19 26.174999999999997 23.375 22.375 28.075 20 25.55 23.7 25.8 24.95 21 25.900000000000002 24.85 23.799999999999997 25.45 22 24.099999999999998 26.900000000000002 22.900000000000002 26.1 23 23.7 26.275 24.8 25.224999999999998 24 23.849999999999998 24.275 23.599999999999998 28.275 25 23.425 24.8 25.5 26.275 26 24.7 24.25 24.125 26.924999999999997 27 24.4 23.150000000000002 23.75 28.7 28 24.95 25.624999999999996 23.5 25.924999999999997 29 25.85 24.65 24.075 25.424999999999997 30 24.075 23.974999999999998 26.075 25.874999999999996 31 25.074999999999996 23.125 23.5 28.299999999999997 32 24.075 26.700000000000003 23.95 25.275 33 24.05 24.65 23.400000000000002 27.900000000000002 34 25.124999999999996 24.825 22.650000000000002 27.400000000000002 35 24.5 24.875 25.55 25.074999999999996 36 24.825 24.25 24.8 26.125 37 26.974999999999998 23.05 23.05 26.924999999999997 38 23.674999999999997 23.549999999999997 26.525 26.25 39 24.625 26.125 23.200000000000003 26.05 40 25.0 26.8 22.0 26.200000000000003 41 24.5 24.4 24.95 26.150000000000002 42 24.325 24.275 23.75 27.650000000000002 43 25.2 23.525 23.775 27.500000000000004 44 23.75 24.85 25.35 26.05 45 25.674999999999997 23.575 24.7 26.05 46 27.750000000000004 22.925 25.324999999999996 24.0 47 24.65 26.700000000000003 22.125 26.525 48 22.925 23.799999999999997 26.85 26.424999999999997 49 27.675 23.724999999999998 22.6 26.0 50 25.25 23.849999999999998 24.099999999999998 26.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 3.0 24 6.0 25 6.0 26 6.0 27 18.5 28 31.0 29 28.5 30 26.0 31 35.5 32 45.0 33 62.0 34 79.0 35 109.0 36 139.0 37 151.5 38 164.0 39 175.5 40 187.0 41 208.0 42 229.0 43 245.0 44 261.0 45 255.0 46 249.0 47 273.0 48 297.0 49 318.0 50 339.0 51 302.5 52 266.0 53 253.5 54 241.0 55 227.0 56 213.0 57 199.0 58 185.0 59 178.0 60 171.0 61 151.5 62 132.0 63 136.0 64 140.0 65 133.0 66 126.0 67 117.0 68 108.0 69 97.0 70 86.0 71 84.5 72 83.0 73 80.0 74 77.0 75 62.0 76 47.0 77 36.0 78 25.0 79 22.5 80 20.0 81 15.0 82 10.0 83 7.0 84 4.0 85 4.0 86 4.0 87 2.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96960329726944 96.05 2 0.9015971148892323 1.7500000000000002 3 0.07727975270479134 0.22499999999999998 4 0.025759917568263783 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025759917568263783 1.875 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 75 1.875 TruSeq Adapter, Index 12 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437204 spots for SRR6322403.sra Written 1437204 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra Read 1437187 spots for SRR6322403.sra Written 1437187 spots for SRR6322403.sra SRR ids: ['SRR6322403.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1kfoynhc SRR6322403.sra spots: 28743757 blocks: [[1, 1437187], [1437188, 2874374], [2874375, 4311561], [4311562, 5748748], [5748749, 7185935], [7185936, 8623122], [8623123, 10060309], [10060310, 11497496], [11497497, 12934683], [12934684, 14371870], [14371871, 15809057], [15809058, 17246244], [17246245, 18683431], [18683432, 20120618], [20120619, 21557805], [21557806, 22994992], [22994993, 24432179], [24432180, 25869366], [25869367, 27306553], [27306554, 28743757]] SRR6322403 file size 4999318 SRR6322403 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322403 SRR6322403_1.fastq Input file: SRR6322403_1.fastq trimmed: SRR6322403-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:04:12 2024 >> started Sat Dec 7 12:04:29 2024 >> done (17.022s) 28743757 reads processed; of these: 13703 ( 0.05%) short reads filtered out after trimming by size control 673588 ( 2.34%) empty reads filtered out after trimming by size control 28056466 (97.61%) reads available; of these: 617805 ( 2.20%) trimmed reads available after processing 27438661 (97.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 779 0.00% 19 789 0.00% 20 869 0.00% 21 943 0.00% 22 1144 0.00% 23 1293 0.00% 24 1634 0.01% 25 2081 0.01% 26 2121 0.01% 27 2352 0.01% 28 2864 0.01% 29 3983 0.01% 30 19344 0.07% 31 10233 0.04% 32 7533 0.03% 33 7042 0.03% 34 7158 0.03% 35 7799 0.03% 36 8213 0.03% 37 9038 0.03% 38 9926 0.04% 39 11876 0.04% 40 13289 0.05% 41 15628 0.06% 42 18745 0.07% 43 23715 0.08% 44 29105 0.10% 45 36472 0.13% 46 47187 0.17% 47 66855 0.24% 48 102861 0.37% 49 144934 0.52% 50 27438661 97.80% 28056466 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=2.3 sequence=GAGCTTGGCGGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=105.99 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=14.7 sequence=CGGCGGCGGCGA Started job on | Dec 07 12:04:40 Started mapping on | Dec 07 12:04:40 Finished on | Dec 07 12:05:04 Mapping speed, Million of reads per hour | 4208.47 Number of input reads | 28056466 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26257293 Uniquely mapped reads % | 93.59% Average mapped length | 49.78 Number of splices: Total | 3408759 Number of splices: Annotated (sjdb) | 3272754 Number of splices: GT/AG | 3363742 Number of splices: GC/AG | 36899 Number of splices: AT/AC | 1762 Number of splices: Non-canonical | 6356 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 537518 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 1044144 % of reads mapped to too many loci | 3.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1261655 1261655 1261655 N_multimapping 537518 537518 537518 N_noFeature 1094826 25635762 1347243 N_ambiguous 390281 1878 21624 UnstrandedReadsAssigned:24772186 PositiveStrandReadsAssigned:619653 NegativeStrandReadsAssigned:24888426 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322403 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322403-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,056,466 reads, 24,556,907 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR6322403.ke.tsv 35125 SRR6322403.se.tsv 88098 total ==> SRR6322403.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 82.75 7.01789 PNS24247 1044 945 4.64555 0.348955 PNS24249 1928 1829 159.313 6.18305 PNS24246 1044 945 4.64555 0.348955 PNS24248 1044 945 4.64555 0.348955 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 1 0.0471972 KQK14071 474 375 0 0 ==> SRR6322403.se.tsv <== BRADI_1g14170v3 1 BRADI_1g53295v3 31 BRADI_1g59795v3 285 BRADI_1g07683v3 0 BRADI_1g00485v3 384 BRADI_1g20270v3 967 BRADI_1g74790v3 113 BRADI_1g09890v3 59 BRADI_1g77505v3 196 BRADI_1g48960v3 0 SRR6322403 completed mapping pipeline successfully