Starting /dee2/code/volunteer_pipeline.sh SRR6322404 current disk space = 1543034859520 free memory = 1603098484 SRR6322404 SRAfilesize ce0b73dc6e3bb55c9805cd3f1c595e55 SRR6322404.sra SRR6322404.sra file validated SRR6322404 is single end SRR6322404 is conventional basespace SRR6322404 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322404_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12375 33.0 33.0 34.0 30.0 34.0 2 32.306 33.0 33.0 34.0 30.0 34.0 3 32.42925 33.0 33.0 34.0 31.0 34.0 4 32.361 33.0 33.0 34.0 31.0 34.0 5 32.4245 33.0 33.0 34.0 31.0 34.0 6 35.96825 38.0 36.0 38.0 31.0 38.0 7 36.5385 38.0 37.0 38.0 34.0 38.0 8 36.49 38.0 38.0 38.0 34.0 38.0 9 36.6585 38.0 38.0 38.0 34.0 38.0 10 36.70475 38.0 38.0 38.0 35.0 38.0 11 36.74575 38.0 38.0 38.0 34.0 38.0 12 36.703 38.0 38.0 38.0 34.0 38.0 13 36.679 38.0 38.0 38.0 34.0 38.0 14 36.64625 38.0 38.0 38.0 34.0 38.0 15 36.58125 38.0 38.0 38.0 34.0 38.0 16 36.5845 38.0 38.0 38.0 34.0 38.0 17 36.72475 38.0 38.0 38.0 35.0 38.0 18 36.78 38.0 38.0 38.0 35.0 38.0 19 36.7075 38.0 38.0 38.0 34.0 38.0 20 36.57475 38.0 38.0 38.0 34.0 38.0 21 36.672 38.0 38.0 38.0 34.0 38.0 22 36.4395 38.0 38.0 38.0 33.0 38.0 23 36.3695 38.0 38.0 38.0 34.0 38.0 24 36.5075 38.0 38.0 38.0 34.0 38.0 25 36.48375 38.0 38.0 38.0 34.0 38.0 26 36.5965 38.0 38.0 38.0 34.0 38.0 27 36.51725 38.0 38.0 38.0 34.0 38.0 28 36.4935 38.0 38.0 38.0 34.0 38.0 29 36.58925 38.0 38.0 38.0 34.0 38.0 30 36.6425 38.0 38.0 38.0 34.0 38.0 31 36.5905 38.0 38.0 38.0 34.0 38.0 32 36.59725 38.0 38.0 38.0 34.0 38.0 33 36.653 38.0 38.0 38.0 35.0 38.0 34 36.5905 38.0 38.0 38.0 34.0 38.0 35 36.5375 38.0 38.0 38.0 34.0 38.0 36 36.47625 38.0 38.0 38.0 34.0 38.0 37 36.52975 38.0 38.0 38.0 34.0 38.0 38 36.5965 38.0 38.0 38.0 34.0 38.0 39 36.528 38.0 38.0 38.0 34.0 38.0 40 36.5035 38.0 38.0 38.0 34.0 38.0 41 36.39725 38.0 38.0 38.0 33.0 38.0 42 36.4835 38.0 38.0 38.0 34.0 38.0 43 36.5355 38.0 38.0 38.0 34.0 38.0 44 36.42 38.0 38.0 38.0 34.0 38.0 45 36.3575 38.0 38.0 38.0 34.0 38.0 46 36.21175 38.0 38.0 38.0 34.0 38.0 47 36.2715 38.0 38.0 38.0 33.0 38.0 48 36.253 38.0 38.0 38.0 34.0 38.0 49 36.20375 38.0 38.0 38.0 34.0 38.0 50 36.119 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 3.0 22 8.0 23 5.0 24 10.0 25 13.0 26 27.0 27 25.0 28 35.0 29 47.0 30 65.0 31 85.0 32 104.0 33 116.0 34 170.0 35 253.0 36 536.0 37 2486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.88835564536499 12.907299823187673 7.754483455418034 41.4498610760293 2 25.874999999999996 19.975 33.650000000000006 20.5 3 23.175 22.650000000000002 20.849999999999998 33.324999999999996 4 29.625 29.549999999999997 17.925 22.900000000000002 5 26.525 32.4 19.625 21.45 6 21.55 29.849999999999998 21.925 26.674999999999997 7 21.224999999999998 15.024999999999999 35.825 27.925 8 22.85 18.975 25.575 32.6 9 22.650000000000002 19.0 28.9 29.45 10 26.05 30.275000000000002 18.575 25.1 11 31.35 19.125 16.625 32.9 12 28.275 16.55 21.725 33.45 13 24.0 21.325 23.775 30.9 14 25.900000000000002 23.825 25.124999999999996 25.15 15 25.4 22.85 23.599999999999998 28.15 16 26.224999999999998 22.45 21.224999999999998 30.099999999999998 17 26.674999999999997 23.5 23.65 26.174999999999997 18 25.78144536134033 22.780695173793447 23.905976494123532 27.53188297074269 19 26.900000000000002 21.975 22.650000000000002 28.475 20 26.275 24.6 23.400000000000002 25.724999999999998 21 23.95 23.1 24.474999999999998 28.475 22 27.125 23.925 21.7 27.250000000000004 23 25.874999999999996 24.175 23.525 26.424999999999997 24 25.674999999999997 22.775000000000002 24.3 27.250000000000004 25 26.974999999999998 22.175 21.825 29.025000000000002 26 25.85 23.775 24.525 25.85 27 25.76288144072036 22.886443221610804 23.736868434217108 27.613806903451728 28 26.450000000000003 23.1 22.275 28.175 29 26.525 24.224999999999998 23.974999999999998 25.275 30 25.575 22.775000000000002 23.575 28.075 31 27.425 23.65 21.85 27.075 32 25.525 24.9 23.775 25.8 33 25.900000000000002 23.799999999999997 22.85 27.450000000000003 34 27.200000000000003 23.025000000000002 22.225 27.55 35 26.724999999999998 24.175 23.575 25.525 36 25.05 22.925 24.425 27.6 37 26.724999999999998 22.625 22.075 28.575 38 26.575 24.325 23.05 26.05 39 25.45 23.125 23.724999999999998 27.700000000000003 40 27.3 22.900000000000002 21.425 28.375 41 25.874999999999996 23.799999999999997 23.599999999999998 26.724999999999998 42 26.75 22.2 23.724999999999998 27.325 43 27.975 22.875 22.025 27.125 44 26.5 23.1 23.3 27.1 45 26.3 22.55 24.099999999999998 27.05 46 26.05 22.525000000000002 23.75 27.675 47 26.75 23.225 23.825 26.200000000000003 48 25.5 21.525 23.95 29.025000000000002 49 27.150000000000002 23.425 21.2 28.225 50 26.974999999999998 24.2 22.6 26.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 8.0 26 13.0 27 14.5 28 16.0 29 23.0 30 30.0 31 32.0 32 34.0 33 40.0 34 46.0 35 77.0 36 108.0 37 111.5 38 115.0 39 145.0 40 175.0 41 191.5 42 208.0 43 216.0 44 224.0 45 243.5 46 263.0 47 261.0 48 259.0 49 254.5 50 250.0 51 253.5 52 257.0 53 245.0 54 233.0 55 209.5 56 186.0 57 197.5 58 209.0 59 216.0 60 223.0 61 209.5 62 196.0 63 180.5 64 165.0 65 163.0 66 161.0 67 151.0 68 141.0 69 123.5 70 106.0 71 110.0 72 114.0 73 101.0 74 88.0 75 81.5 76 75.0 77 57.0 78 39.0 79 36.5 80 34.0 81 25.5 82 17.0 83 10.5 84 4.0 85 4.0 86 4.0 87 3.5 88 3.0 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.025 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91111673841479 97.65 2 0.9622689288427451 1.9 3 0.10129146619397315 0.3 4 0.0 0.0 5 0.0 0.0 6 0.02532286654849329 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133535 spots for SRR6322404.sra Written 1133535 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra Read 1133516 spots for SRR6322404.sra Written 1133516 spots for SRR6322404.sra SRR ids: ['SRR6322404.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ccdjph2 SRR6322404.sra spots: 22670339 blocks: [[1, 1133516], [1133517, 2267032], [2267033, 3400548], [3400549, 4534064], [4534065, 5667580], [5667581, 6801096], [6801097, 7934612], [7934613, 9068128], [9068129, 10201644], [10201645, 11335160], [11335161, 12468676], [12468677, 13602192], [13602193, 14735708], [14735709, 15869224], [15869225, 17002740], [17002741, 18136256], [18136257, 19269772], [19269773, 20403288], [20403289, 21536804], [21536805, 22670339]] SRR6322404 file size 3940697 SRR6322404 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322404 SRR6322404_1.fastq Input file: SRR6322404_1.fastq trimmed: SRR6322404-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:04:12 2024 >> started Sat Dec 7 12:04:27 2024 >> done (15.182s) 22670339 reads processed; of these: 4385 ( 0.02%) short reads filtered out after trimming by size control 43629 ( 0.19%) empty reads filtered out after trimming by size control 22622325 (99.79%) reads available; of these: 518607 ( 2.29%) trimmed reads available after processing 22103718 (97.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 425 0.00% 19 517 0.00% 20 548 0.00% 21 648 0.00% 22 802 0.00% 23 917 0.00% 24 1218 0.01% 25 1549 0.01% 26 1626 0.01% 27 1729 0.01% 28 2184 0.01% 29 3270 0.01% 30 16934 0.07% 31 8864 0.04% 32 6435 0.03% 33 6093 0.03% 34 5849 0.03% 35 6275 0.03% 36 6929 0.03% 37 7435 0.03% 38 8115 0.04% 39 9484 0.04% 40 10762 0.05% 41 12726 0.06% 42 15280 0.07% 43 19367 0.09% 44 23707 0.10% 45 29849 0.13% 46 39466 0.17% 47 56077 0.25% 48 87469 0.39% 49 126058 0.56% 50 22103718 97.71% 22622325 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=22 prefix-density=0.10 prefix-fanout=3.0 sequence=GAGCTTGGCGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=2 fanout-score=66.00 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=12.2 sequence=CGCCGCCGCCGCGCCGACCTCCTCCGCGATCTTGTGCCTGTGCGCGTTTTCCGGGTCCTTCTTTGCCTCGTGCTTCTCGTAGAGGGCGAAGGCGCCAGCGGCGGCGGC Started job on | Dec 07 12:04:37 Started mapping on | Dec 07 12:04:37 Finished on | Dec 07 12:04:58 Mapping speed, Million of reads per hour | 3878.11 Number of input reads | 22622325 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 21561342 Uniquely mapped reads % | 95.31% Average mapped length | 49.79 Number of splices: Total | 2910762 Number of splices: Annotated (sjdb) | 2793928 Number of splices: GT/AG | 2872505 Number of splices: GC/AG | 31116 Number of splices: AT/AC | 1505 Number of splices: Non-canonical | 5636 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411513 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 532559 % of reads mapped to too many loci | 2.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 649470 649470 649470 N_multimapping 411513 411513 411513 N_noFeature 775425 21045831 995164 N_ambiguous 310696 1384 15295 UnstrandedReadsAssigned:20475221 PositiveStrandReadsAssigned:514127 NegativeStrandReadsAssigned:20550883 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322404 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322404-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,622,325 reads, 20,299,458 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR6322404.ke.tsv 35125 SRR6322404.se.tsv 88098 total ==> SRR6322404.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 44.7498 4.46424 PNS24247 1044 945 3.41053 0.301351 PNS24249 1928 1829 156.615 7.14992 PNS24246 1044 945 3.41053 0.301351 PNS24248 1044 945 3.41053 0.301351 PNS24244 1471 1372 7.40387 0.450595 PNS24243 293 194 0 0 KQK14069 1603 1504 6.66076 0.369792 KQK14071 474 375 3.39241 0.755369 ==> SRR6322404.se.tsv <== BRADI_1g14170v3 11 BRADI_1g53295v3 18 BRADI_1g59795v3 158 BRADI_1g07683v3 0 BRADI_1g00485v3 618 BRADI_1g20270v3 1627 BRADI_1g74790v3 38 BRADI_1g09890v3 116 BRADI_1g77505v3 112 BRADI_1g48960v3 0 SRR6322404 completed mapping pipeline successfully