Starting /dee2/code/volunteer_pipeline.sh SRR6322405 current disk space = 1543056326656 free memory = 1600961032 SRR6322405 SRAfilesize 85dadec768120cdced72396fcbd2c6b0 SRR6322405.sra SRR6322405.sra file validated SRR6322405 is single end SRR6322405 is conventional basespace SRR6322405 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322405_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.17875 33.0 33.0 34.0 31.0 34.0 2 32.472 33.0 33.0 34.0 31.0 34.0 3 32.518 34.0 33.0 34.0 31.0 34.0 4 32.50175 33.0 33.0 34.0 31.0 34.0 5 32.4955 34.0 33.0 34.0 31.0 34.0 6 35.99475 38.0 36.0 38.0 31.0 38.0 7 36.523 38.0 37.0 38.0 34.0 38.0 8 36.56375 38.0 38.0 38.0 34.0 38.0 9 36.49475 38.0 38.0 38.0 34.0 38.0 10 36.68125 38.0 38.0 38.0 34.0 38.0 11 36.595 38.0 38.0 38.0 34.0 38.0 12 36.73625 38.0 38.0 38.0 34.0 38.0 13 36.77875 38.0 38.0 38.0 35.0 38.0 14 36.545 38.0 38.0 38.0 34.0 38.0 15 36.58325 38.0 38.0 38.0 34.0 38.0 16 36.61825 38.0 38.0 38.0 34.0 38.0 17 36.5775 38.0 38.0 38.0 34.0 38.0 18 36.7415 38.0 38.0 38.0 35.0 38.0 19 36.6155 38.0 38.0 38.0 34.0 38.0 20 36.605 38.0 38.0 38.0 34.0 38.0 21 36.748 38.0 38.0 38.0 35.0 38.0 22 36.492 38.0 38.0 38.0 34.0 38.0 23 36.46125 38.0 38.0 38.0 34.0 38.0 24 36.66375 38.0 38.0 38.0 34.0 38.0 25 36.628 38.0 38.0 38.0 34.0 38.0 26 36.71025 38.0 38.0 38.0 34.0 38.0 27 36.6785 38.0 38.0 38.0 34.0 38.0 28 36.60075 38.0 38.0 38.0 34.0 38.0 29 36.61875 38.0 38.0 38.0 34.0 38.0 30 36.675 38.0 38.0 38.0 34.0 38.0 31 36.75775 38.0 38.0 38.0 35.0 38.0 32 36.6635 38.0 38.0 38.0 34.0 38.0 33 36.65975 38.0 38.0 38.0 34.0 38.0 34 36.60275 38.0 38.0 38.0 34.0 38.0 35 36.51275 38.0 38.0 38.0 34.0 38.0 36 36.507 38.0 38.0 38.0 34.0 38.0 37 36.52775 38.0 38.0 38.0 34.0 38.0 38 36.59325 38.0 38.0 38.0 34.0 38.0 39 36.5605 38.0 38.0 38.0 34.0 38.0 40 36.51575 38.0 38.0 38.0 34.0 38.0 41 36.43025 38.0 38.0 38.0 34.0 38.0 42 36.50525 38.0 38.0 38.0 34.0 38.0 43 36.65175 38.0 38.0 38.0 34.0 38.0 44 36.545 38.0 38.0 38.0 34.0 38.0 45 36.34775 38.0 38.0 38.0 34.0 38.0 46 36.23325 38.0 38.0 38.0 33.0 38.0 47 36.197 38.0 38.0 38.0 33.0 38.0 48 36.28725 38.0 38.0 38.0 34.0 38.0 49 36.2655 38.0 38.0 38.0 34.0 38.0 50 36.06575 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 2.0 18 0.0 19 2.0 20 0.0 21 3.0 22 1.0 23 4.0 24 5.0 25 9.0 26 24.0 27 34.0 28 32.0 29 62.0 30 61.0 31 86.0 32 106.0 33 120.0 34 170.0 35 242.0 36 563.0 37 2468.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.26128868594622 13.723997970573313 8.574327752409944 42.44038559107052 2 25.074999999999996 20.424999999999997 34.375 20.125 3 21.5 25.424999999999997 22.575 30.5 4 26.950000000000003 30.599999999999998 18.45 24.0 5 26.375 30.349999999999998 21.825 21.45 6 19.75 30.75 23.5 26.0 7 19.400000000000002 15.775 38.800000000000004 26.025 8 21.925 19.15 27.075 31.85 9 21.425 17.9 30.9 29.775000000000002 10 25.1 30.599999999999998 21.075 23.225 11 30.525000000000002 18.224999999999998 17.875 33.375 12 27.275 17.474999999999998 22.725 32.525 13 22.675 22.650000000000002 25.025 29.65 14 23.799999999999997 25.124999999999996 25.575 25.5 15 22.975 23.849999999999998 25.825 27.35 16 25.924999999999997 22.725 23.775 27.575 17 24.0 24.075 25.424999999999997 26.5 18 23.375 24.15 26.0 26.474999999999998 19 26.125 23.674999999999997 23.925 26.275 20 23.674999999999997 23.674999999999997 24.925 27.725 21 23.125 24.575 25.35 26.950000000000003 22 24.8 23.95 24.8 26.450000000000003 23 24.65 24.2 24.2 26.950000000000003 24 22.825 24.175 26.400000000000002 26.6 25 25.124999999999996 22.775000000000002 24.425 27.675 26 24.175 24.05 25.474999999999998 26.3 27 23.175 25.124999999999996 25.45 26.25 28 25.4 23.599999999999998 23.549999999999997 27.450000000000003 29 23.575 25.324999999999996 24.875 26.224999999999998 30 24.25 24.625 25.05 26.075 31 24.825 23.375 24.3 27.500000000000004 32 24.875 25.7 23.674999999999997 25.75 33 23.65 23.875 25.8 26.674999999999997 34 24.7 24.275 23.275000000000002 27.750000000000004 35 24.3 24.4 24.625 26.674999999999997 36 24.349999999999998 24.224999999999998 24.9 26.525 37 24.275 25.174999999999997 23.825 26.724999999999998 38 24.775 25.25 23.375 26.6 39 23.7 24.625 25.474999999999998 26.200000000000003 40 25.424999999999997 23.799999999999997 23.674999999999997 27.1 41 24.525 25.25 24.55 25.674999999999997 42 23.925 23.75 25.474999999999998 26.85 43 25.025 23.65 24.7 26.625 44 25.124999999999996 23.849999999999998 24.85 26.174999999999997 45 24.25 24.125 25.224999999999998 26.400000000000002 46 25.55 22.425 24.725 27.3 47 26.075 24.85 23.95 25.124999999999996 48 24.15 23.35 25.374999999999996 27.125 49 25.7 24.474999999999998 23.9 25.924999999999997 50 25.674999999999997 24.025 24.3 26.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 3.0 25 4.0 26 5.0 27 10.0 28 15.0 29 20.5 30 26.0 31 38.0 32 50.0 33 71.0 34 92.0 35 100.5 36 109.0 37 133.0 38 157.0 39 192.5 40 228.0 41 244.0 42 260.0 43 255.5 44 251.0 45 274.0 46 297.0 47 297.0 48 297.0 49 303.0 50 309.0 51 290.0 52 271.0 53 249.0 54 227.0 55 215.0 56 203.0 57 195.5 58 188.0 59 172.0 60 156.0 61 151.5 62 147.0 63 145.0 64 143.0 65 140.0 66 137.0 67 116.5 68 96.0 69 93.0 70 90.0 71 88.5 72 87.0 73 71.5 74 56.0 75 49.0 76 42.0 77 31.5 78 21.0 79 18.5 80 16.0 81 14.5 82 13.0 83 8.5 84 4.0 85 3.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16582406471183 98.075 2 0.6572295247724975 1.3 3 0.10111223458038424 0.3 4 0.05055611729019212 0.2 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417169 spots for SRR6322405.sra Written 2417169 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra Read 2417154 spots for SRR6322405.sra Written 2417154 spots for SRR6322405.sra SRR ids: ['SRR6322405.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ovqlnv_c SRR6322405.sra spots: 48343095 blocks: [[1, 2417154], [2417155, 4834308], [4834309, 7251462], [7251463, 9668616], [9668617, 12085770], [12085771, 14502924], [14502925, 16920078], [16920079, 19337232], [19337233, 21754386], [21754387, 24171540], [24171541, 26588694], [26588695, 29005848], [29005849, 31423002], [31423003, 33840156], [33840157, 36257310], [36257311, 38674464], [38674465, 41091618], [41091619, 43508772], [43508773, 45925926], [45925927, 48343095]] SRR6322405 file size 8415588 SRR6322405 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322405 SRR6322405_1.fastq Input file: SRR6322405_1.fastq trimmed: SRR6322405-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:05:10 2024 >> started Sat Dec 7 12:05:45 2024 >> done (35.577s) 48343095 reads processed; of these: 18386 ( 0.04%) short reads filtered out after trimming by size control 73785 ( 0.15%) empty reads filtered out after trimming by size control 48250924 (99.81%) reads available; of these: 997883 ( 2.07%) trimmed reads available after processing 47253041 (97.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1092 0.00% 19 893 0.00% 20 1036 0.00% 21 1256 0.00% 22 1589 0.00% 23 1754 0.00% 24 2250 0.00% 25 3011 0.01% 26 3197 0.01% 27 3405 0.01% 28 4258 0.01% 29 6558 0.01% 30 33351 0.07% 31 17452 0.04% 32 12677 0.03% 33 11811 0.02% 34 11705 0.02% 35 12376 0.03% 36 13661 0.03% 37 14629 0.03% 38 15832 0.03% 39 18992 0.04% 40 21386 0.04% 41 25040 0.05% 42 30433 0.06% 43 38053 0.08% 44 46506 0.10% 45 57877 0.12% 46 76083 0.16% 47 108359 0.22% 48 165888 0.34% 49 235473 0.49% 50 47253041 97.93% 48250924 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=54.76 fanout-score-rank=2 prefix-density=0.38 prefix-fanout=11.4 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCGGTTGATCAAAAGCTCGAGGAGCTAGCTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=82.44 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.4 sequence=CGGCGGCGGCGA Started job on | Dec 07 12:05:56 Started mapping on | Dec 07 12:05:56 Finished on | Dec 07 12:06:37 Mapping speed, Million of reads per hour | 4236.67 Number of input reads | 48250924 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 45454824 Uniquely mapped reads % | 94.21% Average mapped length | 49.79 Number of splices: Total | 6499326 Number of splices: Annotated (sjdb) | 6202390 Number of splices: GT/AG | 6407112 Number of splices: GC/AG | 76451 Number of splices: AT/AC | 2896 Number of splices: Non-canonical | 12867 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1207002 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 1378689 % of reads mapped to too many loci | 2.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1589098 1589098 1589098 N_multimapping 1207002 1207002 1207002 N_noFeature 2178471 44352536 2640102 N_ambiguous 688177 3013 49521 UnstrandedReadsAssigned:42588176 PositiveStrandReadsAssigned:1099275 NegativeStrandReadsAssigned:42765201 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322405 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322405-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,250,924 reads, 42,282,484 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52973 SRR6322405.ke.tsv 35125 SRR6322405.se.tsv 88098 total ==> SRR6322405.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 95.9258 4.5989 PNS24247 1044 945 63.3693 2.69086 PNS24249 1928 1829 203.51 4.46493 PNS24246 1044 945 63.3693 2.69086 PNS24248 1044 945 63.3693 2.69086 PNS24244 1471 1372 48.4568 1.41724 PNS24243 293 194 0 0 KQK14069 1603 1504 45.7585 1.22086 KQK14071 474 375 18.8947 2.02186 ==> SRR6322405.se.tsv <== BRADI_1g14170v3 81 BRADI_1g53295v3 245 BRADI_1g59795v3 991 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 890 BRADI_1g74790v3 731 BRADI_1g09890v3 11 BRADI_1g77505v3 636 BRADI_1g48960v3 8 SRR6322405 completed mapping pipeline successfully