Starting /dee2/code/volunteer_pipeline.sh SRR6322406 current disk space = 1543561748480 free memory = 1602300232 SRR6322406 SRAfilesize b10492f633d17f1b5a99fbc53ef14cee SRR6322406.sra SRR6322406.sra file validated SRR6322406 is single end SRR6322406 is conventional basespace SRR6322406 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322406_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.187 33.0 33.0 34.0 30.0 34.0 2 32.35925 33.0 33.0 34.0 30.0 34.0 3 32.34975 33.0 33.0 34.0 30.0 34.0 4 32.29475 33.0 33.0 34.0 31.0 34.0 5 32.3245 33.0 33.0 34.0 31.0 34.0 6 35.86975 38.0 36.0 38.0 31.0 38.0 7 36.4225 38.0 37.0 38.0 33.0 38.0 8 36.59325 38.0 38.0 38.0 34.0 38.0 9 36.5365 38.0 38.0 38.0 34.0 38.0 10 36.6305 38.0 38.0 38.0 34.0 38.0 11 36.71025 38.0 38.0 38.0 34.0 38.0 12 36.63425 38.0 38.0 38.0 34.0 38.0 13 36.61125 38.0 38.0 38.0 34.0 38.0 14 36.50525 38.0 38.0 38.0 34.0 38.0 15 36.4965 38.0 38.0 38.0 34.0 38.0 16 36.60675 38.0 38.0 38.0 34.0 38.0 17 36.60575 38.0 38.0 38.0 34.0 38.0 18 36.6205 38.0 38.0 38.0 34.0 38.0 19 36.5375 38.0 38.0 38.0 34.0 38.0 20 36.422 38.0 38.0 38.0 34.0 38.0 21 36.54375 38.0 38.0 38.0 34.0 38.0 22 36.436 38.0 38.0 38.0 34.0 38.0 23 36.31325 38.0 38.0 38.0 33.0 38.0 24 36.504 38.0 38.0 38.0 34.0 38.0 25 36.323 38.0 38.0 38.0 33.0 38.0 26 36.44775 38.0 38.0 38.0 34.0 38.0 27 36.4765 38.0 38.0 38.0 34.0 38.0 28 36.332 38.0 38.0 38.0 33.0 38.0 29 36.50975 38.0 38.0 38.0 34.0 38.0 30 36.4885 38.0 38.0 38.0 34.0 38.0 31 36.4235 38.0 38.0 38.0 34.0 38.0 32 36.5675 38.0 38.0 38.0 34.0 38.0 33 36.46975 38.0 38.0 38.0 34.0 38.0 34 36.4355 38.0 38.0 38.0 34.0 38.0 35 36.352 38.0 38.0 38.0 34.0 38.0 36 36.3965 38.0 38.0 38.0 33.0 38.0 37 36.43425 38.0 38.0 38.0 34.0 38.0 38 36.48825 38.0 38.0 38.0 34.0 38.0 39 36.46425 38.0 38.0 38.0 34.0 38.0 40 36.34325 38.0 38.0 38.0 34.0 38.0 41 36.26175 38.0 38.0 38.0 33.0 38.0 42 36.369 38.0 38.0 38.0 33.0 38.0 43 36.42325 38.0 38.0 38.0 34.0 38.0 44 36.298 38.0 38.0 38.0 33.0 38.0 45 36.30225 38.0 38.0 38.0 33.0 38.0 46 36.11225 38.0 38.0 38.0 33.0 38.0 47 36.15375 38.0 38.0 38.0 33.0 38.0 48 36.09225 38.0 38.0 38.0 33.0 38.0 49 36.02725 38.0 38.0 38.0 33.0 38.0 50 35.989 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 1.0 20 3.0 21 1.0 22 1.0 23 3.0 24 8.0 25 16.0 26 28.0 27 29.0 28 33.0 29 52.0 30 71.0 31 96.0 32 127.0 33 160.0 34 169.0 35 240.0 36 550.0 37 2401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.56675062972292 15.692695214105793 8.463476070528968 40.277078085642316 2 23.9 21.099999999999998 35.3 19.7 3 21.625 25.825 22.6 29.95 4 25.35 31.3 19.575 23.775 5 25.237618809404704 32.44122061030515 22.011005502751377 20.31015507753877 6 19.825 30.325000000000003 23.575 26.275 7 19.25 16.55 38.35 25.85 8 20.225 19.85 27.625 32.300000000000004 9 22.3 19.400000000000002 29.375 28.925 10 24.975 30.125 21.275 23.625 11 30.0 20.275000000000002 19.425 30.3 12 27.625 17.224999999999998 22.325 32.824999999999996 13 23.225 22.275 24.375 30.125 14 24.275 24.474999999999998 27.0 24.25 15 24.075 23.425 24.6 27.900000000000002 16 24.4 25.8 23.150000000000002 26.650000000000002 17 25.124999999999996 24.975 25.35 24.55 18 24.65 24.349999999999998 24.8 26.200000000000003 19 24.725 24.349999999999998 23.35 27.575 20 23.275000000000002 25.724999999999998 25.025 25.974999999999998 21 24.15 24.85 25.174999999999997 25.825 22 26.025 23.75 24.3 25.924999999999997 23 24.5 24.5 26.25 24.75 24 23.925 23.9 25.900000000000002 26.275 25 23.974999999999998 25.124999999999996 23.375 27.525 26 25.0 24.474999999999998 24.625 25.900000000000002 27 24.4 22.6 25.474999999999998 27.525 28 24.95 24.55 23.849999999999998 26.650000000000002 29 23.674999999999997 25.575 26.0 24.75 30 24.975 24.275 23.625 27.125 31 23.875 25.55 23.7 26.875 32 24.8 25.35 24.224999999999998 25.624999999999996 33 24.325 24.9 24.525 26.25 34 25.575 24.9 23.474999999999998 26.05 35 25.15 25.324999999999996 25.35 24.175 36 23.0 24.375 23.974999999999998 28.65 37 24.275 23.9 25.2 26.625 38 23.974999999999998 25.974999999999998 23.474999999999998 26.575 39 23.974999999999998 23.400000000000002 25.45 27.175 40 24.9 24.2 24.775 26.125 41 24.4 25.55 24.45 25.6 42 24.05 23.549999999999997 25.275 27.125 43 25.124999999999996 23.75 24.15 26.974999999999998 44 24.325 25.35 24.3 26.025 45 22.975 23.875 25.8 27.35 46 25.900000000000002 23.925 23.9 26.275 47 23.974999999999998 23.35 26.875 25.8 48 23.549999999999997 24.7 24.975 26.775 49 25.35 24.45 23.799999999999997 26.400000000000002 50 24.65 23.150000000000002 26.325 25.874999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 3.0 22 3.0 23 3.0 24 3.0 25 6.0 26 9.0 27 15.0 28 21.0 29 26.5 30 32.0 31 42.5 32 53.0 33 68.0 34 83.0 35 98.5 36 114.0 37 140.0 38 166.0 39 197.0 40 228.0 41 250.0 42 272.0 43 279.5 44 287.0 45 301.5 46 316.0 47 299.0 48 282.0 49 291.5 50 301.0 51 281.5 52 262.0 53 251.0 54 240.0 55 217.0 56 194.0 57 179.0 58 164.0 59 158.5 60 153.0 61 161.0 62 169.0 63 150.5 64 132.0 65 119.5 66 107.0 67 101.5 68 96.0 69 89.0 70 82.0 71 72.0 72 62.0 73 59.0 74 56.0 75 48.5 76 41.0 77 33.0 78 25.0 79 27.0 80 29.0 81 18.0 82 7.0 83 5.5 84 4.0 85 2.5 86 1.0 87 2.0 88 3.0 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11571500757958 98.075 2 0.7832238504295099 1.55 3 0.05053057099545225 0.15 4 0.025265285497726126 0.1 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992292 spots for SRR6322406.sra Written 992292 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra Read 992287 spots for SRR6322406.sra Written 992287 spots for SRR6322406.sra SRR ids: ['SRR6322406.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dmy_uj5e SRR6322406.sra spots: 19845745 blocks: [[1, 992287], [992288, 1984574], [1984575, 2976861], [2976862, 3969148], [3969149, 4961435], [4961436, 5953722], [5953723, 6946009], [6946010, 7938296], [7938297, 8930583], [8930584, 9922870], [9922871, 10915157], [10915158, 11907444], [11907445, 12899731], [12899732, 13892018], [13892019, 14884305], [14884306, 15876592], [15876593, 16868879], [16868880, 17861166], [17861167, 18853453], [18853454, 19845745]] SRR6322406 file size 3448356 SRR6322406 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322406 SRR6322406_1.fastq Input file: SRR6322406_1.fastq trimmed: SRR6322406-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:26:25 2024 >> started Sat Dec 7 10:26:35 2024 >> done (9.975s) 19845745 reads processed; of these: 7731 ( 0.04%) short reads filtered out after trimming by size control 26506 ( 0.13%) empty reads filtered out after trimming by size control 19811508 (99.83%) reads available; of these: 420646 ( 2.12%) trimmed reads available after processing 19390862 (97.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 479 0.00% 19 533 0.00% 20 614 0.00% 21 633 0.00% 22 769 0.00% 23 935 0.00% 24 1063 0.01% 25 1370 0.01% 26 1452 0.01% 27 1577 0.01% 28 1941 0.01% 29 2779 0.01% 30 12331 0.06% 31 6569 0.03% 32 4957 0.03% 33 4709 0.02% 34 4904 0.02% 35 5040 0.03% 36 5585 0.03% 37 5901 0.03% 38 6665 0.03% 39 8016 0.04% 40 9090 0.05% 41 10621 0.05% 42 12922 0.07% 43 15919 0.08% 44 19336 0.10% 45 24382 0.12% 46 33012 0.17% 47 46855 0.24% 48 70695 0.36% 49 98992 0.50% 50 19390862 97.88% 19811508 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=50.62 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.7 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCGGTTGATCAAAAGCTCGAGGAGCTAGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=1 fanout-score=50.62 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.7 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCGGTTGATCAAAAGCTCGAGGAGCTAGCT Started job on | Dec 07 10:26:48 Started mapping on | Dec 07 10:26:48 Finished on | Dec 07 10:27:04 Mapping speed, Million of reads per hour | 4457.59 Number of input reads | 19811508 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18678820 Uniquely mapped reads % | 94.28% Average mapped length | 49.80 Number of splices: Total | 2662566 Number of splices: Annotated (sjdb) | 2550279 Number of splices: GT/AG | 2625356 Number of splices: GC/AG | 31039 Number of splices: AT/AC | 1228 Number of splices: Non-canonical | 4943 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435148 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 580241 % of reads mapped to too many loci | 2.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 697540 697540 697540 N_multimapping 435148 435148 435148 N_noFeature 911796 18224739 1091274 N_ambiguous 293121 1296 19213 UnstrandedReadsAssigned:17473903 PositiveStrandReadsAssigned:452785 NegativeStrandReadsAssigned:17568333 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322406 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322406-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,811,508 reads, 17,356,264 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52973 SRR6322406.ke.tsv 35125 SRR6322406.se.tsv 88098 total ==> SRR6322406.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 66.5025 8.01206 PNS24247 1044 945 14.1073 1.50537 PNS24249 1928 1829 96.0525 5.29574 PNS24246 1044 945 14.1073 1.50537 PNS24248 1044 945 14.1073 1.50537 PNS24244 1471 1372 18.123 1.33201 PNS24243 293 194 0 0 KQK14069 1603 1504 3.99646 0.267953 KQK14071 474 375 1.01132 0.271951 ==> SRR6322406.se.tsv <== BRADI_1g14170v3 5 BRADI_1g53295v3 59 BRADI_1g59795v3 374 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 363 BRADI_1g74790v3 283 BRADI_1g09890v3 13 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR6322406 completed mapping pipeline successfully