Starting /dee2/code/volunteer_pipeline.sh SRR6322408 current disk space = 1543038611456 free memory = 1599880024 SRR6322408 SRAfilesize eb6b172e23f8f5f8ce67ad8aa24537d0 SRR6322408.sra SRR6322408.sra file validated SRR6322408 is single end SRR6322408 is conventional basespace SRR6322408 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322408_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.26575 33.0 33.0 34.0 31.0 34.0 2 32.43325 33.0 33.0 34.0 31.0 34.0 3 32.5125 34.0 33.0 34.0 31.0 34.0 4 32.4185 34.0 33.0 34.0 31.0 34.0 5 32.40575 33.0 33.0 34.0 31.0 34.0 6 35.94575 38.0 36.0 38.0 31.0 38.0 7 36.34625 38.0 37.0 38.0 33.0 38.0 8 36.549 38.0 38.0 38.0 34.0 38.0 9 36.4835 38.0 38.0 38.0 34.0 38.0 10 36.59225 38.0 38.0 38.0 34.0 38.0 11 36.57 38.0 38.0 38.0 34.0 38.0 12 36.58775 38.0 38.0 38.0 34.0 38.0 13 36.579 38.0 38.0 38.0 34.0 38.0 14 36.65575 38.0 38.0 38.0 34.0 38.0 15 36.64825 38.0 38.0 38.0 34.0 38.0 16 36.61525 38.0 38.0 38.0 34.0 38.0 17 36.6725 38.0 38.0 38.0 34.0 38.0 18 36.5815 38.0 38.0 38.0 34.0 38.0 19 36.51125 38.0 38.0 38.0 34.0 38.0 20 36.5205 38.0 38.0 38.0 34.0 38.0 21 36.63375 38.0 38.0 38.0 34.0 38.0 22 36.628 38.0 38.0 38.0 34.0 38.0 23 36.626 38.0 38.0 38.0 34.0 38.0 24 36.6445 38.0 38.0 38.0 34.0 38.0 25 36.6075 38.0 38.0 38.0 34.0 38.0 26 36.51575 38.0 38.0 38.0 34.0 38.0 27 36.5235 38.0 38.0 38.0 34.0 38.0 28 36.49425 38.0 38.0 38.0 34.0 38.0 29 36.56575 38.0 38.0 38.0 34.0 38.0 30 36.5845 38.0 38.0 38.0 34.0 38.0 31 36.525 38.0 38.0 38.0 34.0 38.0 32 36.578 38.0 38.0 38.0 34.0 38.0 33 36.4265 38.0 38.0 38.0 34.0 38.0 34 36.5075 38.0 38.0 38.0 34.0 38.0 35 36.5555 38.0 38.0 38.0 34.0 38.0 36 36.5005 38.0 38.0 38.0 34.0 38.0 37 36.515 38.0 38.0 38.0 34.0 38.0 38 36.36725 38.0 38.0 38.0 34.0 38.0 39 36.48275 38.0 38.0 38.0 34.0 38.0 40 36.39375 38.0 38.0 38.0 34.0 38.0 41 36.5015 38.0 38.0 38.0 34.0 38.0 42 36.3685 38.0 38.0 38.0 34.0 38.0 43 36.3875 38.0 38.0 38.0 33.0 38.0 44 36.419 38.0 38.0 38.0 34.0 38.0 45 36.32325 38.0 38.0 38.0 33.0 38.0 46 36.26525 38.0 38.0 38.0 33.0 38.0 47 36.28725 38.0 38.0 38.0 34.0 38.0 48 36.35625 38.0 38.0 38.0 34.0 38.0 49 36.1975 38.0 38.0 38.0 33.0 38.0 50 36.04975 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 2.0 23 6.0 24 12.0 25 8.0 26 26.0 27 36.0 28 35.0 29 53.0 30 47.0 31 98.0 32 105.0 33 145.0 34 188.0 35 270.0 36 535.0 37 2425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.44108761329305 14.098690835850958 8.408862034239679 43.051359516616316 2 25.025 20.775 34.925 19.275000000000002 3 21.525 23.549999999999997 21.975 32.95 4 26.325 32.775 18.925 21.975 5 25.10627656914228 32.13303325831458 21.705426356589147 21.05526381595399 6 20.225 31.45 22.6 25.724999999999998 7 19.8 16.150000000000002 39.75 24.3 8 21.075 19.45 27.325 32.15 9 20.549999999999997 18.425 29.95 31.075000000000003 10 23.1 31.65 21.775 23.474999999999998 11 28.925 19.625 18.325 33.125 12 27.85 16.725 22.45 32.975 13 22.025 22.425 26.375 29.175 14 23.525 24.975 26.875 24.625 15 23.549999999999997 24.15 26.075 26.224999999999998 16 23.425 24.425 24.5 27.650000000000002 17 23.025000000000002 25.374999999999996 25.45 26.150000000000002 18 23.3 23.724999999999998 25.775 27.200000000000003 19 24.125 25.05 23.65 27.175 20 25.2 25.0 25.124999999999996 24.675 21 23.9 23.599999999999998 25.525 26.974999999999998 22 22.8 25.025 25.55 26.625 23 24.85 24.15 26.35 24.65 24 23.025000000000002 24.875 25.525 26.575 25 24.425 23.7 24.15 27.725 26 23.775 24.6 25.275 26.35 27 24.125 23.549999999999997 25.15 27.175 28 24.7 24.675 24.625 26.0 29 22.975 25.650000000000002 25.074999999999996 26.3 30 23.3 24.15 26.724999999999998 25.825 31 25.474999999999998 23.5 25.424999999999997 25.6 32 24.125 24.675 25.0 26.200000000000003 33 23.3 24.075 26.775 25.85 34 24.0 25.275 24.474999999999998 26.25 35 23.5 26.224999999999998 24.625 25.650000000000002 36 25.224999999999998 23.474999999999998 24.9 26.400000000000002 37 24.224999999999998 24.275 24.099999999999998 27.400000000000002 38 23.825 24.625 25.525 26.025 39 23.175 23.9 26.174999999999997 26.75 40 25.224999999999998 23.849999999999998 25.85 25.074999999999996 41 25.025 25.05 24.525 25.4 42 23.674999999999997 24.05 25.324999999999996 26.950000000000003 43 24.45 24.825 24.4 26.325 44 24.4 25.25 25.974999999999998 24.375 45 24.0 23.724999999999998 25.45 26.825 46 23.95 23.95 25.074999999999996 27.025 47 23.724999999999998 25.0 25.674999999999997 25.6 48 24.325 23.5 25.624999999999996 26.55 49 24.675 24.425 24.675 26.224999999999998 50 23.3 25.724999999999998 24.474999999999998 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.0 24 6.0 25 6.5 26 7.0 27 10.0 28 13.0 29 21.0 30 29.0 31 41.5 32 54.0 33 62.0 34 70.0 35 102.0 36 134.0 37 152.5 38 171.0 39 193.5 40 216.0 41 235.0 42 254.0 43 296.0 44 338.0 45 310.5 46 283.0 47 288.5 48 294.0 49 299.0 50 304.0 51 297.0 52 290.0 53 277.5 54 265.0 55 235.0 56 205.0 57 197.5 58 190.0 59 179.5 60 169.0 61 154.5 62 140.0 63 128.0 64 116.0 65 105.5 66 95.0 67 102.5 68 110.0 69 94.5 70 79.0 71 63.5 72 48.0 73 40.5 74 33.0 75 33.5 76 34.0 77 27.0 78 20.0 79 16.5 80 13.0 81 11.5 82 10.0 83 7.5 84 5.0 85 4.0 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93536121673003 97.575 2 0.8111533586818758 1.6 3 0.17743979721166034 0.525 4 0.07604562737642585 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900410 spots for SRR6322408.sra Written 900410 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra Read 900407 spots for SRR6322408.sra Written 900407 spots for SRR6322408.sra SRR ids: ['SRR6322408.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0bs63gse SRR6322408.sra spots: 18008143 blocks: [[1, 900407], [900408, 1800814], [1800815, 2701221], [2701222, 3601628], [3601629, 4502035], [4502036, 5402442], [5402443, 6302849], [6302850, 7203256], [7203257, 8103663], [8103664, 9004070], [9004071, 9904477], [9904478, 10804884], [10804885, 11705291], [11705292, 12605698], [12605699, 13506105], [13506106, 14406512], [14406513, 15306919], [15306920, 16207326], [16207327, 17107733], [17107734, 18008143]] SRR6322408 file size 3128081 SRR6322408 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322408 SRR6322408_1.fastq Input file: SRR6322408_1.fastq trimmed: SRR6322408-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:06:36 2024 >> started Sat Dec 7 12:06:47 2024 >> done (10.074s) 18008143 reads processed; of these: 6891 ( 0.04%) short reads filtered out after trimming by size control 13803 ( 0.08%) empty reads filtered out after trimming by size control 17987449 (99.89%) reads available; of these: 255311 ( 1.42%) trimmed reads available after processing 17732138 (98.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 321 0.00% 19 293 0.00% 20 296 0.00% 21 323 0.00% 22 411 0.00% 23 482 0.00% 24 610 0.00% 25 769 0.00% 26 723 0.00% 27 776 0.00% 28 866 0.00% 29 919 0.01% 30 1040 0.01% 31 1207 0.01% 32 1334 0.01% 33 1559 0.01% 34 1704 0.01% 35 2061 0.01% 36 2369 0.01% 37 2784 0.02% 38 3352 0.02% 39 3925 0.02% 40 4857 0.03% 41 5961 0.03% 42 7557 0.04% 43 9542 0.05% 44 12082 0.07% 45 16557 0.09% 46 22919 0.13% 47 30799 0.17% 48 47534 0.26% 49 69379 0.39% 50 17732138 98.58% 17987449 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=23 prefix-density=0.10 prefix-fanout=2.0 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=80.03 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.4 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTC Started job on | Dec 07 12:06:58 Started mapping on | Dec 07 12:06:58 Finished on | Dec 07 12:07:14 Mapping speed, Million of reads per hour | 4047.18 Number of input reads | 17987449 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16330704 Uniquely mapped reads % | 90.79% Average mapped length | 49.85 Number of splices: Total | 2590938 Number of splices: Annotated (sjdb) | 2467617 Number of splices: GT/AG | 2553759 Number of splices: GC/AG | 31335 Number of splices: AT/AC | 1162 Number of splices: Non-canonical | 4682 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 887501 % of reads mapped to multiple loci | 4.93% Number of reads mapped to too many loci | 631052 % of reads mapped to too many loci | 3.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 769244 769244 769244 N_multimapping 887501 887501 887501 N_noFeature 951996 15930492 1113940 N_ambiguous 270527 1139 32166 UnstrandedReadsAssigned:15108181 PositiveStrandReadsAssigned:399073 NegativeStrandReadsAssigned:15184598 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322408 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322408-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,987,449 reads, 15,230,278 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR6322408.ke.tsv 35125 SRR6322408.se.tsv 88098 total ==> SRR6322408.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 92.2576 12.2136 PNS24247 1044 945 41.2921 4.84175 PNS24249 1928 1829 67.0562 4.0625 PNS24246 1044 945 41.2921 4.84175 PNS24248 1044 945 41.2921 4.84175 PNS24244 1471 1372 44.8098 3.61898 PNS24243 293 194 0 0 KQK14069 1603 1504 4001.31 294.796 KQK14071 474 375 2209.11 652.76 ==> SRR6322408.se.tsv <== BRADI_1g14170v3 7791 BRADI_1g53295v3 90 BRADI_1g59795v3 578 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 102 BRADI_1g74790v3 259 BRADI_1g09890v3 0 BRADI_1g77505v3 193 BRADI_1g48960v3 1 SRR6322408 completed mapping pipeline successfully