Starting /dee2/code/volunteer_pipeline.sh SRR6322412 current disk space = 1543460950016 free memory = 1605925480 SRR6322412 SRAfilesize d5216a9d79b6419d3b55c4321d83e333 SRR6322412.sra SRR6322412.sra file validated SRR6322412 is single end SRR6322412 is conventional basespace SRR6322412 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322412_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3235 33.0 33.0 34.0 31.0 34.0 2 32.53575 33.0 33.0 34.0 31.0 34.0 3 32.46975 33.0 33.0 34.0 31.0 34.0 4 32.4425 33.0 33.0 34.0 31.0 34.0 5 32.48075 33.0 33.0 34.0 31.0 34.0 6 35.97075 38.0 36.0 38.0 31.0 38.0 7 36.32975 38.0 37.0 38.0 33.0 38.0 8 36.649 38.0 38.0 38.0 34.0 38.0 9 36.60775 38.0 38.0 38.0 34.0 38.0 10 36.671 38.0 38.0 38.0 34.0 38.0 11 36.735 38.0 38.0 38.0 34.0 38.0 12 36.73575 38.0 38.0 38.0 34.0 38.0 13 36.683 38.0 38.0 38.0 34.0 38.0 14 36.73625 38.0 38.0 38.0 34.0 38.0 15 36.75175 38.0 38.0 38.0 34.0 38.0 16 36.63375 38.0 38.0 38.0 34.0 38.0 17 36.727 38.0 38.0 38.0 35.0 38.0 18 36.637 38.0 38.0 38.0 34.0 38.0 19 36.666 38.0 38.0 38.0 34.0 38.0 20 36.5655 38.0 38.0 38.0 34.0 38.0 21 36.57625 38.0 38.0 38.0 34.0 38.0 22 36.659 38.0 38.0 38.0 34.0 38.0 23 36.695 38.0 38.0 38.0 34.0 38.0 24 36.70325 38.0 38.0 38.0 34.0 38.0 25 36.64825 38.0 38.0 38.0 34.0 38.0 26 36.66575 38.0 38.0 38.0 34.0 38.0 27 36.63125 38.0 38.0 38.0 34.0 38.0 28 36.61375 38.0 38.0 38.0 34.0 38.0 29 36.552 38.0 38.0 38.0 34.0 38.0 30 36.5445 38.0 38.0 38.0 34.0 38.0 31 36.68125 38.0 38.0 38.0 34.0 38.0 32 36.64625 38.0 38.0 38.0 34.0 38.0 33 36.68175 38.0 38.0 38.0 34.0 38.0 34 36.521 38.0 38.0 38.0 34.0 38.0 35 36.526 38.0 38.0 38.0 34.0 38.0 36 36.53725 38.0 38.0 38.0 34.0 38.0 37 36.49375 38.0 38.0 38.0 34.0 38.0 38 36.5695 38.0 38.0 38.0 34.0 38.0 39 36.4515 38.0 38.0 38.0 34.0 38.0 40 36.36725 38.0 38.0 38.0 33.0 38.0 41 36.493 38.0 38.0 38.0 34.0 38.0 42 36.4745 38.0 38.0 38.0 34.0 38.0 43 36.367 38.0 38.0 38.0 34.0 38.0 44 36.37 38.0 38.0 38.0 33.0 38.0 45 36.394 38.0 38.0 38.0 34.0 38.0 46 36.40025 38.0 38.0 38.0 34.0 38.0 47 36.373 38.0 38.0 38.0 34.0 38.0 48 36.34075 38.0 38.0 38.0 34.0 38.0 49 36.15425 38.0 38.0 38.0 33.0 38.0 50 36.156 38.0 38.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 4.0 24 13.0 25 16.0 26 11.0 27 29.0 28 42.0 29 51.0 30 69.0 31 81.0 32 84.0 33 159.0 34 183.0 35 281.0 36 528.0 37 2441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.72062531517902 14.069591527987896 9.959657085224407 38.250126071608676 2 25.224999999999998 18.975 33.475 22.325 3 22.925 23.05 24.55 29.475 4 25.424999999999997 30.349999999999998 21.375 22.85 5 24.8 30.875000000000004 21.775 22.55 6 19.675 32.375 23.400000000000002 24.55 7 17.775 17.5 39.574999999999996 25.15 8 20.925 20.225 26.35 32.5 9 19.525000000000002 19.45 30.175 30.85 10 24.05 32.9 19.85 23.200000000000003 11 28.875 20.875 18.5 31.75 12 25.074999999999996 19.6 24.224999999999998 31.1 13 23.325000000000003 23.599999999999998 26.1 26.974999999999998 14 22.25 25.0 25.7 27.05 15 23.200000000000003 24.474999999999998 23.674999999999997 28.65 16 23.025000000000002 25.25 24.45 27.275 17 24.375 25.15 23.200000000000003 27.275 18 23.275000000000002 25.224999999999998 24.55 26.950000000000003 19 23.75 24.975 24.925 26.35 20 24.099999999999998 24.775 25.5 25.624999999999996 21 23.799999999999997 24.175 25.5 26.525 22 24.425 24.6 23.95 27.025 23 23.549999999999997 24.9 24.6 26.950000000000003 24 23.375 24.175 25.275 27.175 25 23.400000000000002 23.9 25.124999999999996 27.575 26 22.7 24.975 24.4 27.925 27 21.65 24.975 26.35 27.025 28 23.799999999999997 24.8 22.975 28.425 29 24.425 24.725 25.25 25.6 30 22.95 24.5 24.85 27.700000000000003 31 23.400000000000002 23.150000000000002 25.2 28.249999999999996 32 23.0 25.825 24.775 26.400000000000002 33 24.099999999999998 23.599999999999998 26.224999999999998 26.075 34 25.25 25.05 23.525 26.174999999999997 35 23.525 25.55 24.224999999999998 26.700000000000003 36 23.125 25.275 23.9 27.700000000000003 37 24.525 25.724999999999998 23.150000000000002 26.6 38 23.45 24.575 24.375 27.6 39 23.974999999999998 25.4 24.775 25.85 40 25.35 24.125 23.325000000000003 27.200000000000003 41 24.175 24.6 24.55 26.674999999999997 42 23.724999999999998 23.95 24.775 27.55 43 24.625 24.275 24.375 26.724999999999998 44 22.650000000000002 26.174999999999997 24.625 26.55 45 23.95 25.1 24.099999999999998 26.85 46 23.35 24.474999999999998 24.474999999999998 27.700000000000003 47 24.15 23.875 24.875 27.1 48 22.875 24.25 25.8 27.075 49 24.05 23.799999999999997 24.725 27.425 50 23.425 25.75 25.525 25.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 2.5 22 3.0 23 3.5 24 4.0 25 7.5 26 11.0 27 16.0 28 21.0 29 26.5 30 32.0 31 43.5 32 55.0 33 72.5 34 90.0 35 116.0 36 142.0 37 152.5 38 163.0 39 193.5 40 224.0 41 241.0 42 258.0 43 278.0 44 298.0 45 287.5 46 277.0 47 288.5 48 300.0 49 297.0 50 294.0 51 277.0 52 260.0 53 250.5 54 241.0 55 213.5 56 186.0 57 190.5 58 195.0 59 195.5 60 196.0 61 163.0 62 130.0 63 128.0 64 126.0 65 117.5 66 109.0 67 97.5 68 86.0 69 88.5 70 91.0 71 75.5 72 60.0 73 53.0 74 46.0 75 43.0 76 40.0 77 32.0 78 24.0 79 23.5 80 23.0 81 14.5 82 6.0 83 5.5 84 5.0 85 2.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 96.99895615866389 92.925 2 2.2181628392484343 4.25 3 0.46972860125260957 1.35 4 0.1304801670146138 0.5 5 0.10438413361169101 0.5 6 0.052192066805845504 0.3 7 0.026096033402922752 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 7 0.17500000000000002 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 6 0.15 No Hit CCTTGCTCGCGCTCCCGGCGCCGTTCTTCCTCGCTGCTCTGCTCGTGCTC 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) GTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTTGATTTC 5 0.125 No Hit CGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATAA 5 0.125 No Hit CGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202547 spots for SRR6322412.sra Written 1202547 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra Read 1202536 spots for SRR6322412.sra Written 1202536 spots for SRR6322412.sra SRR ids: ['SRR6322412.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e4x0hn9i SRR6322412.sra spots: 24050731 blocks: [[1, 1202536], [1202537, 2405072], [2405073, 3607608], [3607609, 4810144], [4810145, 6012680], [6012681, 7215216], [7215217, 8417752], [8417753, 9620288], [9620289, 10822824], [10822825, 12025360], [12025361, 13227896], [13227897, 14430432], [14430433, 15632968], [15632969, 16835504], [16835505, 18038040], [18038041, 19240576], [19240577, 20443112], [20443113, 21645648], [21645649, 22848184], [22848185, 24050731]] SRR6322412 file size 4181340 SRR6322412 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322412 SRR6322412_1.fastq Input file: SRR6322412_1.fastq trimmed: SRR6322412-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:34:01 2024 >> started Sat Dec 7 10:34:13 2024 >> done (12.748s) 24050731 reads processed; of these: 4844 ( 0.02%) short reads filtered out after trimming by size control 56585 ( 0.24%) empty reads filtered out after trimming by size control 23989302 (99.74%) reads available; of these: 363045 ( 1.51%) trimmed reads available after processing 23626257 (98.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 352 0.00% 19 406 0.00% 20 467 0.00% 21 454 0.00% 22 620 0.00% 23 694 0.00% 24 865 0.00% 25 1075 0.00% 26 1100 0.00% 27 1119 0.00% 28 1252 0.01% 29 1314 0.01% 30 1466 0.01% 31 1736 0.01% 32 1867 0.01% 33 2180 0.01% 34 2435 0.01% 35 2904 0.01% 36 3522 0.01% 37 3927 0.02% 38 4718 0.02% 39 5614 0.02% 40 6791 0.03% 41 8453 0.04% 42 11013 0.05% 43 13498 0.06% 44 16700 0.07% 45 23095 0.10% 46 32152 0.13% 47 43989 0.18% 48 68376 0.29% 49 98891 0.41% 50 23626257 98.49% 23989302 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.81 fanout-score-rank=13 prefix-density=0.41 prefix-fanout=3.2 sequence=GCTGCTGCTGCTCGGGCCCGGGGAGGAAGCCTTTTTTCTTCTGGTTGCCCCTGACCATCTCGTCCACGGCCCTGGCGTCGCCGAAGGCCAGGTCCTTGGAGATCCTGTCGAGCTGGCTGAACACGTTGTTGGCTCCGGCGAGGTACACCCTGTCGTTCTTCTCGGCGCGGATCTCGAAGCAGGCGATCTGGAGGTTGTTGTTGTCGTCGCCGCCGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=62.26 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=9.6 sequence=CGCCGCCGCGGGAGGAGGACGCGATCTCCACCACCGGGTGGCCCGGGGGCACC Started job on | Dec 07 10:34:33 Started mapping on | Dec 07 10:34:33 Finished on | Dec 07 10:35:04 Mapping speed, Million of reads per hour | 2785.85 Number of input reads | 23989302 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 19593796 Uniquely mapped reads % | 81.68% Average mapped length | 49.79 Number of splices: Total | 2422740 Number of splices: Annotated (sjdb) | 2312685 Number of splices: GT/AG | 2389058 Number of splices: GC/AG | 27437 Number of splices: AT/AC | 1560 Number of splices: Non-canonical | 4685 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 672216 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 3476438 % of reads mapped to too many loci | 14.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.84% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3723290 3723290 3723290 N_multimapping 672216 672216 672216 N_noFeature 1178582 19101157 1422888 N_ambiguous 269964 1334 21846 UnstrandedReadsAssigned:18145250 PositiveStrandReadsAssigned:491305 NegativeStrandReadsAssigned:18149062 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322412 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322412-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,989,302 reads, 18,141,527 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6322412.ke.tsv 35125 SRR6322412.se.tsv 88098 total ==> SRR6322412.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 76.2012 7.94125 PNS24247 1044 945 65.2494 6.02279 PNS24249 1928 1829 208.758 9.95592 PNS24246 1044 945 65.2494 6.02279 PNS24248 1044 945 65.2494 6.02279 PNS24244 1471 1372 170.293 10.8267 PNS24243 293 194 0 0 KQK14069 1603 1504 39.3492 2.28213 KQK14071 474 375 6.68512 1.555 ==> SRR6322412.se.tsv <== BRADI_1g14170v3 45 BRADI_1g53295v3 663 BRADI_1g59795v3 540 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 1448 BRADI_1g74790v3 9 BRADI_1g09890v3 0 BRADI_1g77505v3 382 BRADI_1g48960v3 0 SRR6322412 completed mapping pipeline successfully