Starting /dee2/code/volunteer_pipeline.sh SRR6322413 current disk space = 1543448657920 free memory = 1595733584 SRR6322413 SRAfilesize 84949b2d2fd984dbebbea0ef20ff5eea SRR6322413.sra SRR6322413.sra file validated SRR6322413 is single end SRR6322413 is conventional basespace SRR6322413 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322413_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39725 33.0 33.0 34.0 31.0 34.0 2 32.486 34.0 33.0 34.0 30.0 34.0 3 32.52725 34.0 33.0 34.0 31.0 34.0 4 32.41625 34.0 33.0 34.0 31.0 34.0 5 32.4375 33.0 33.0 34.0 31.0 34.0 6 35.906 38.0 36.0 38.0 31.0 38.0 7 36.4175 38.0 37.0 38.0 34.0 38.0 8 36.48725 38.0 38.0 38.0 34.0 38.0 9 36.58625 38.0 38.0 38.0 34.0 38.0 10 36.7285 38.0 38.0 38.0 34.0 38.0 11 36.7375 38.0 38.0 38.0 34.0 38.0 12 36.66275 38.0 38.0 38.0 34.0 38.0 13 36.706 38.0 38.0 38.0 34.0 38.0 14 36.76925 38.0 38.0 38.0 35.0 38.0 15 36.781 38.0 38.0 38.0 34.0 38.0 16 36.71175 38.0 38.0 38.0 34.0 38.0 17 36.7585 38.0 38.0 38.0 34.0 38.0 18 36.75575 38.0 38.0 38.0 34.0 38.0 19 36.7075 38.0 38.0 38.0 34.0 38.0 20 36.7475 38.0 38.0 38.0 34.0 38.0 21 36.68975 38.0 38.0 38.0 34.0 38.0 22 36.6885 38.0 38.0 38.0 34.0 38.0 23 36.681 38.0 38.0 38.0 34.0 38.0 24 36.70775 38.0 38.0 38.0 35.0 38.0 25 36.761 38.0 38.0 38.0 35.0 38.0 26 36.65775 38.0 38.0 38.0 34.0 38.0 27 36.673 38.0 38.0 38.0 34.0 38.0 28 36.63975 38.0 38.0 38.0 34.0 38.0 29 36.64475 38.0 38.0 38.0 34.0 38.0 30 36.65475 38.0 38.0 38.0 34.0 38.0 31 36.62975 38.0 38.0 38.0 34.0 38.0 32 36.5655 38.0 38.0 38.0 34.0 38.0 33 36.59525 38.0 38.0 38.0 34.0 38.0 34 36.53775 38.0 38.0 38.0 34.0 38.0 35 36.4565 38.0 38.0 38.0 34.0 38.0 36 36.571 38.0 38.0 38.0 34.0 38.0 37 36.50875 38.0 38.0 38.0 34.0 38.0 38 36.62 38.0 38.0 38.0 34.0 38.0 39 36.65375 38.0 38.0 38.0 34.0 38.0 40 36.58075 38.0 38.0 38.0 34.0 38.0 41 36.50675 38.0 38.0 38.0 34.0 38.0 42 36.50025 38.0 38.0 38.0 34.0 38.0 43 36.50875 38.0 38.0 38.0 34.0 38.0 44 36.504 38.0 38.0 38.0 34.0 38.0 45 36.5935 38.0 38.0 38.0 34.0 38.0 46 36.51775 38.0 38.0 38.0 34.0 38.0 47 36.4815 38.0 38.0 38.0 34.0 38.0 48 36.413 38.0 38.0 38.0 34.0 38.0 49 36.2245 38.0 38.0 38.0 34.0 38.0 50 36.3455 38.0 38.0 38.0 34.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 9.0 25 13.0 26 17.0 27 25.0 28 29.0 29 60.0 30 62.0 31 100.0 32 109.0 33 124.0 34 168.0 35 286.0 36 535.0 37 2456.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.66834677419355 15.221774193548388 8.644153225806452 39.465725806451616 2 25.6 21.075 33.6 19.725 3 20.150000000000002 26.724999999999998 23.35 29.775000000000002 4 25.75 31.8 20.724999999999998 21.725 5 24.85621405351338 32.358089522380595 21.405351337834457 21.380345086271568 6 18.875 32.75 22.975 25.4 7 19.3 16.475 39.375 24.85 8 21.2 20.375 26.200000000000003 32.225 9 19.775000000000002 18.775 30.175 31.275 10 22.05 33.475 21.0 23.474999999999998 11 28.125 20.424999999999997 18.05 33.4 12 26.625 18.05 22.400000000000002 32.925 13 22.275 23.925 25.575 28.225 14 22.975 25.650000000000002 25.525 25.85 15 23.35 23.724999999999998 25.074999999999996 27.85 16 24.025 25.275 23.599999999999998 27.1 17 24.325 24.55 24.224999999999998 26.900000000000002 18 24.125 25.05 25.55 25.275 19 24.025 25.074999999999996 24.275 26.625 20 23.525 25.5 24.6 26.375 21 23.65 24.925 24.575 26.85 22 23.7 25.85 24.0 26.450000000000003 23 23.849999999999998 25.025 25.224999999999998 25.900000000000002 24 22.900000000000002 25.15 25.825 26.125 25 22.45 26.25 24.275 27.025 26 23.325000000000003 24.7 24.675 27.3 27 21.75 25.474999999999998 25.575 27.200000000000003 28 23.625 25.900000000000002 25.0 25.474999999999998 29 24.425 24.6 26.224999999999998 24.75 30 22.3 24.2 26.450000000000003 27.05 31 23.575 25.224999999999998 25.874999999999996 25.324999999999996 32 24.6 25.05 24.0 26.35 33 23.724999999999998 24.825 26.25 25.2 34 24.474999999999998 24.925 24.025 26.575 35 23.7 26.125 24.325 25.85 36 24.0 25.974999999999998 24.925 25.1 37 23.175 24.925 25.224999999999998 26.674999999999997 38 23.775 26.075 24.625 25.525 39 23.45 24.25 25.75 26.55 40 24.325 24.65 23.875 27.150000000000002 41 23.849999999999998 25.5 25.324999999999996 25.324999999999996 42 23.525 25.324999999999996 25.95 25.2 43 25.1 23.625 25.0 26.275 44 23.075000000000003 25.1 25.775 26.05 45 22.95 26.075 23.974999999999998 27.0 46 23.525 24.4 24.95 27.125 47 21.825 24.8 26.125 27.250000000000004 48 23.775 24.175 25.6 26.450000000000003 49 25.275 25.025 21.85 27.85 50 23.325000000000003 25.474999999999998 25.424999999999997 25.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 4.0 24 6.0 25 8.5 26 11.0 27 17.5 28 24.0 29 25.5 30 27.0 31 42.5 32 58.0 33 68.5 34 79.0 35 102.5 36 126.0 37 153.5 38 181.0 39 197.0 40 213.0 41 239.5 42 266.0 43 275.5 44 285.0 45 293.5 46 302.0 47 318.5 48 335.0 49 329.0 50 323.0 51 297.5 52 272.0 53 265.5 54 259.0 55 241.0 56 223.0 57 217.0 58 211.0 59 191.5 60 172.0 61 149.5 62 127.0 63 120.5 64 114.0 65 97.5 66 81.0 67 77.5 68 74.0 69 67.5 70 61.0 71 57.5 72 54.0 73 50.0 74 46.0 75 39.5 76 33.0 77 23.5 78 14.0 79 13.0 80 12.0 81 7.0 82 2.0 83 3.5 84 5.0 85 3.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 97.19748559455212 92.77499999999999 2 1.754845468831849 3.35 3 0.6547930853850183 1.875 4 0.20953378732320588 0.8 5 0.0785751702462022 0.375 6 0.026191723415400735 0.15 7 0.026191723415400735 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05238344683080147 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGAC 10 0.25 No Hit CAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGG 10 0.25 No Hit GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 7 0.17500000000000002 No Hit CAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCT 6 0.15 No Hit CGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGA 5 0.125 No Hit CAAGATTACCCGGGCCTGTCGGCCAAGGCTATATACTCGTTGAATACATC 5 0.125 No Hit GAACGATTTGCACGTCAGTATCGCTTCGAGCCTCCACCAGAGTTTCCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235696 spots for SRR6322413.sra Written 1235696 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra Read 1235678 spots for SRR6322413.sra Written 1235678 spots for SRR6322413.sra SRR ids: ['SRR6322413.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ok5vl_ls SRR6322413.sra spots: 24713578 blocks: [[1, 1235678], [1235679, 2471356], [2471357, 3707034], [3707035, 4942712], [4942713, 6178390], [6178391, 7414068], [7414069, 8649746], [8649747, 9885424], [9885425, 11121102], [11121103, 12356780], [12356781, 13592458], [13592459, 14828136], [14828137, 16063814], [16063815, 17299492], [17299493, 18535170], [18535171, 19770848], [19770849, 21006526], [21006527, 22242204], [22242205, 23477882], [23477883, 24713578]] SRR6322413 file size 4296871 SRR6322413 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322413 SRR6322413_1.fastq Input file: SRR6322413_1.fastq trimmed: SRR6322413-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:34:02 2024 >> started Sat Dec 7 10:34:18 2024 >> done (16.315s) 24713578 reads processed; of these: 6788 ( 0.03%) short reads filtered out after trimming by size control 38687 ( 0.16%) empty reads filtered out after trimming by size control 24668103 (99.82%) reads available; of these: 352028 ( 1.43%) trimmed reads available after processing 24316075 (98.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 367 0.00% 19 370 0.00% 20 395 0.00% 21 450 0.00% 22 554 0.00% 23 618 0.00% 24 808 0.00% 25 998 0.00% 26 1113 0.00% 27 1063 0.00% 28 1121 0.00% 29 1273 0.01% 30 1414 0.01% 31 1624 0.01% 32 1813 0.01% 33 2239 0.01% 34 2487 0.01% 35 2812 0.01% 36 3401 0.01% 37 3918 0.02% 38 4672 0.02% 39 5618 0.02% 40 6740 0.03% 41 8089 0.03% 42 10556 0.04% 43 12989 0.05% 44 16427 0.07% 45 22137 0.09% 46 31219 0.13% 47 42540 0.17% 48 66561 0.27% 49 95642 0.39% 50 24316075 98.57% 24668103 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.64 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=1.9 sequence=CGACGGTCTAAACCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTTGCCCCGCTTCCGACCCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=56.23 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=13.5 sequence=TGCTGCTGCTGG Started job on | Dec 07 10:34:36 Started mapping on | Dec 07 10:34:37 Finished on | Dec 07 10:35:02 Mapping speed, Million of reads per hour | 3552.21 Number of input reads | 24668103 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20079372 Uniquely mapped reads % | 81.40% Average mapped length | 49.84 Number of splices: Total | 2897249 Number of splices: Annotated (sjdb) | 2787918 Number of splices: GT/AG | 2858540 Number of splices: GC/AG | 32855 Number of splices: AT/AC | 1614 Number of splices: Non-canonical | 4240 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 892318 % of reads mapped to multiple loci | 3.62% Number of reads mapped to too many loci | 3511103 % of reads mapped to too many loci | 14.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3696413 3696413 3696413 N_multimapping 892318 892318 892318 N_noFeature 968728 19259584 1127054 N_ambiguous 689668 1356 28585 UnstrandedReadsAssigned:18420976 PositiveStrandReadsAssigned:818432 NegativeStrandReadsAssigned:18923733 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322413 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322413-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,668,103 reads, 18,965,601 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52973 SRR6322413.ke.tsv 35125 SRR6322413.se.tsv 88098 total ==> SRR6322413.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 164.638 16.7759 PNS24247 1044 945 6.01517 0.542869 PNS24249 1928 1829 84.9275 3.96017 PNS24246 1044 945 6.01517 0.542869 PNS24248 1044 945 6.01517 0.542869 PNS24244 1471 1372 107.389 6.67549 PNS24243 293 194 0 0 KQK14069 1603 1504 608.068 34.4813 KQK14071 474 375 101.336 23.0469 ==> SRR6322413.se.tsv <== BRADI_1g14170v3 784 BRADI_1g53295v3 91 BRADI_1g59795v3 447 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 1116 BRADI_1g74790v3 41 BRADI_1g09890v3 13 BRADI_1g77505v3 324 BRADI_1g48960v3 0 SRR6322413 completed mapping pipeline successfully