Starting /dee2/code/volunteer_pipeline.sh SRR6322417 current disk space = 1543124045824 free memory = 1603226156 SRR6322417 SRAfilesize 6c7ca8bea77bf7d9b064bd1a77d50b21 SRR6322417.sra SRR6322417.sra file validated SRR6322417 is single end SRR6322417 is conventional basespace SRR6322417 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.80625 32.0 32.0 32.0 27.0 32.0 2 31.22875 32.0 32.0 32.0 32.0 32.0 3 34.68125 37.0 32.0 37.0 32.0 37.0 4 35.6475 37.0 37.0 37.0 32.0 37.0 5 36.6375 37.0 37.0 37.0 37.0 37.0 6 40.01225 41.0 41.0 41.0 37.0 41.0 7 39.6405 41.0 41.0 41.0 37.0 41.0 8 39.49425 41.0 41.0 41.0 37.0 41.0 9 39.797 41.0 41.0 41.0 37.0 41.0 10 40.403 41.0 41.0 41.0 41.0 41.0 11 40.17475 41.0 41.0 41.0 37.0 41.0 12 40.34975 41.0 41.0 41.0 41.0 41.0 13 40.15325 41.0 41.0 41.0 41.0 41.0 14 39.6915 41.0 41.0 41.0 37.0 41.0 15 39.582 41.0 41.0 41.0 37.0 41.0 16 39.28925 41.0 41.0 41.0 37.0 41.0 17 40.194 41.0 41.0 41.0 37.0 41.0 18 39.994 41.0 41.0 41.0 37.0 41.0 19 39.7035 41.0 41.0 41.0 37.0 41.0 20 39.379 41.0 41.0 41.0 37.0 41.0 21 40.182 41.0 41.0 41.0 37.0 41.0 22 39.709 41.0 41.0 41.0 37.0 41.0 23 39.66475 41.0 41.0 41.0 37.0 41.0 24 39.65325 41.0 41.0 41.0 37.0 41.0 25 40.029 41.0 41.0 41.0 37.0 41.0 26 39.72425 41.0 41.0 41.0 37.0 41.0 27 39.78925 41.0 41.0 41.0 37.0 41.0 28 38.62225 41.0 41.0 41.0 32.0 41.0 29 39.53675 41.0 41.0 41.0 37.0 41.0 30 39.70725 41.0 41.0 41.0 37.0 41.0 31 38.24275 41.0 41.0 41.0 32.0 41.0 32 39.021 41.0 41.0 41.0 37.0 41.0 33 38.0845 41.0 41.0 41.0 27.0 41.0 34 39.1745 41.0 41.0 41.0 37.0 41.0 35 38.69475 41.0 41.0 41.0 32.0 41.0 36 39.40775 41.0 41.0 41.0 37.0 41.0 37 38.69025 41.0 41.0 41.0 32.0 41.0 38 38.579 41.0 41.0 41.0 32.0 41.0 39 39.72575 41.0 41.0 41.0 37.0 41.0 40 40.0 41.0 41.0 41.0 37.0 41.0 41 35.681 41.0 37.0 41.0 12.0 41.0 42 38.25125 41.0 37.0 41.0 32.0 41.0 43 39.61525 41.0 41.0 41.0 37.0 41.0 44 38.67575 41.0 41.0 41.0 32.0 41.0 45 33.472 41.0 27.0 41.0 12.0 41.0 46 38.62725 41.0 37.0 41.0 32.0 41.0 47 37.41675 41.0 37.0 41.0 27.0 41.0 48 37.32825 41.0 37.0 41.0 27.0 41.0 49 37.318 41.0 37.0 41.0 27.0 41.0 50 38.3005 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 3.0 25 3.0 26 7.0 27 8.0 28 18.0 29 32.0 30 40.0 31 58.0 32 75.0 33 104.0 34 126.0 35 139.0 36 160.0 37 240.0 38 383.0 39 835.0 40 1766.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.42177722152691 11.11389236545682 6.783479349186483 44.680851063829785 2 22.118064352672917 11.375728401317456 38.83962503166962 27.666582214340007 3 20.674999999999997 13.625000000000002 23.875 41.825 4 27.425 20.075000000000003 21.325 31.175000000000004 5 26.6 25.55 24.45 23.400000000000002 6 23.625 29.15 23.275000000000002 23.95 7 18.05 25.900000000000002 37.475 18.575 8 22.175 23.175 30.4 24.25 9 19.6 20.7 35.25 24.45 10 22.15 32.625 25.3 19.925 11 24.825 24.4 22.475 28.299999999999997 12 24.45 22.05 25.674999999999997 27.825 13 23.7 25.924999999999997 25.275 25.1 14 24.45 23.575 26.525 25.45 15 23.3 25.124999999999996 24.575 27.0 16 23.325000000000003 24.4 24.15 28.125 17 24.8 24.6 25.025 25.575 18 22.400000000000002 25.525 26.025 26.05 19 24.85 24.575 25.0 25.575 20 25.424999999999997 25.224999999999998 24.775 24.575 21 25.45 24.55 24.099999999999998 25.900000000000002 22 23.5 24.625 26.25 25.624999999999996 23 24.875 25.1 25.650000000000002 24.375 24 24.525 24.575 23.225 27.675 25 23.65 24.975 24.3 27.075 26 24.099999999999998 24.45 25.1 26.35 27 22.775000000000002 23.925 25.224999999999998 28.075 28 24.7 23.875 23.9 27.525 29 24.725 24.4 25.224999999999998 25.650000000000002 30 23.674999999999997 23.549999999999997 25.374999999999996 27.400000000000002 31 24.3 24.125 23.95 27.625 32 23.400000000000002 24.825 25.3 26.474999999999998 33 22.675 24.95 25.724999999999998 26.650000000000002 34 23.825 25.1 24.275 26.8 35 24.175 24.25 25.575 26.0 36 24.349999999999998 24.65 24.725 26.275 37 24.25 25.124999999999996 24.575 26.05 38 23.875 25.5 24.275 26.35 39 23.599999999999998 24.45 24.725 27.224999999999998 40 22.25 24.875 24.474999999999998 28.4 41 25.174999999999997 25.275 25.374999999999996 24.175 42 22.75 25.074999999999996 26.55 25.624999999999996 43 23.625 24.474999999999998 24.75 27.150000000000002 44 23.925 23.275000000000002 25.2 27.6 45 24.0 24.925 25.05 26.025 46 24.6 23.1 25.374999999999996 26.924999999999997 47 24.175 23.05 25.575 27.200000000000003 48 23.625 23.974999999999998 25.0 27.400000000000002 49 24.025 24.6 24.875 26.5 50 23.7 24.675 26.325 25.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.5 26 3.0 27 10.0 28 17.0 29 23.5 30 30.0 31 39.0 32 48.0 33 62.5 34 77.0 35 111.0 36 145.0 37 162.0 38 179.0 39 212.0 40 245.0 41 266.0 42 287.0 43 297.5 44 308.0 45 300.0 46 292.0 47 303.0 48 314.0 49 301.5 50 289.0 51 281.0 52 273.0 53 248.0 54 223.0 55 217.5 56 212.0 57 192.0 58 172.0 59 148.5 60 125.0 61 128.5 62 132.0 63 124.0 64 116.0 65 123.5 66 131.0 67 114.0 68 97.0 69 87.0 70 77.0 71 77.0 72 77.0 73 63.5 74 50.0 75 40.5 76 31.0 77 27.5 78 24.0 79 19.5 80 15.0 81 8.5 82 2.0 83 1.5 84 1.0 85 1.5 86 2.0 87 1.0 88 0.0 89 1.0 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 1.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.3 #Duplication Level Percentage of deduplicated Percentage of total 1 96.65109034267913 93.075 2 3.14122533748702 6.05 3 0.12980269989615784 0.375 4 0.05192107995846314 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02596053997923157 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 12 0.3 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425870 READS because READLEN < 1 Read 1425870 spots for SRR6322417.sra Written 1425870 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra Rejected 1425862 READS because READLEN < 1 Read 1425862 spots for SRR6322417.sra Written 1425862 spots for SRR6322417.sra SRR ids: ['SRR6322417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yon7mg4d SRR6322417.sra spots: 28517248 blocks: [[1, 1425862], [1425863, 2851724], [2851725, 4277586], [4277587, 5703448], [5703449, 7129310], [7129311, 8555172], [8555173, 9981034], [9981035, 11406896], [11406897, 12832758], [12832759, 14258620], [14258621, 15684482], [15684483, 17110344], [17110345, 18536206], [18536207, 19962068], [19962069, 21387930], [21387931, 22813792], [22813793, 24239654], [24239655, 25665516], [25665517, 27091378], [27091379, 28517248]] SRR6322417 file size 3988537 SRR6322417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322417 SRR6322417_1.fastq Input file: SRR6322417_1.fastq trimmed: SRR6322417-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:13:32 2024 >> started Sat Dec 7 12:13:42 2024 >> done (9.651s) 28517248 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 71406 ( 0.25%) empty reads filtered out after trimming by size control 28445787 (99.75%) reads available; of these: 3346 ( 0.01%) trimmed reads available after processing 28442441 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3334 0.01% 50 28442441 99.99% 28445787 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=29 prefix-density=0.06 prefix-fanout=2.0 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=211.27 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=24.6 sequence=CTTCTTCTTCTGCTCCGGGGTGAACTCCGGCAGCCGTGATCCCACGAGGCCGCGCATGGTGGCCGGGTACTCGCCGAACGTCACGGGGTGCTGGAACCAGCCCAACATGAAGTCCAAGC Started job on | Dec 07 12:13:51 Started mapping on | Dec 07 12:13:52 Finished on | Dec 07 12:14:18 Mapping speed, Million of reads per hour | 3938.65 Number of input reads | 28445787 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 27439519 Uniquely mapped reads % | 96.46% Average mapped length | 49.81 Number of splices: Total | 4275346 Number of splices: Annotated (sjdb) | 4155071 Number of splices: GT/AG | 4204865 Number of splices: GC/AG | 63474 Number of splices: AT/AC | 3101 Number of splices: Non-canonical | 3906 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 730953 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 76064 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.69% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 275315 275315 275315 N_multimapping 730953 730953 730953 N_noFeature 951761 26909707 1107317 N_ambiguous 400322 1990 28444 UnstrandedReadsAssigned:26087436 PositiveStrandReadsAssigned:527822 NegativeStrandReadsAssigned:26303758 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322417 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322417-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,445,787 reads, 26,064,186 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6322417.ke.tsv 35125 SRR6322417.se.tsv 88098 total ==> SRR6322417.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.216242 0.0167347 PNS24247 1044 945 79.1602 5.42601 PNS24249 1928 1829 423.433 14.996 PNS24246 1044 945 79.1602 5.42601 PNS24248 1044 945 79.1602 5.42601 PNS24244 1471 1372 73.8697 3.48752 PNS24243 293 194 0 0 KQK14069 1603 1504 12842.6 553.108 KQK14071 474 375 2050.94 354.263 ==> SRR6322417.se.tsv <== BRADI_1g14170v3 16048 BRADI_1g53295v3 157 BRADI_1g59795v3 454 BRADI_1g07683v3 0 BRADI_1g00485v3 84 BRADI_1g20270v3 2602 BRADI_1g74790v3 383 BRADI_1g09890v3 0 BRADI_1g77505v3 358 BRADI_1g48960v3 1 SRR6322417 completed mapping pipeline successfully