Starting /dee2/code/volunteer_pipeline.sh SRR6322418 current disk space = 1543134445568 free memory = 1598306476 SRR6322418 SRAfilesize 36addd9fce0406fe2d5796a8991712ec SRR6322418.sra SRR6322418.sra file validated SRR6322418 is single end SRR6322418 is conventional basespace SRR6322418 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322418_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.9075 32.0 32.0 32.0 27.0 32.0 2 31.4125 32.0 32.0 32.0 32.0 32.0 3 34.96375 37.0 32.0 37.0 32.0 37.0 4 35.85375 37.0 37.0 37.0 32.0 37.0 5 36.65875 37.0 37.0 37.0 37.0 37.0 6 40.12625 41.0 41.0 41.0 37.0 41.0 7 39.77625 41.0 41.0 41.0 37.0 41.0 8 39.6585 41.0 41.0 41.0 37.0 41.0 9 39.967 41.0 41.0 41.0 37.0 41.0 10 40.40775 41.0 41.0 41.0 41.0 41.0 11 40.20875 41.0 41.0 41.0 37.0 41.0 12 40.39975 41.0 41.0 41.0 41.0 41.0 13 40.29075 41.0 41.0 41.0 41.0 41.0 14 39.66925 41.0 41.0 41.0 37.0 41.0 15 39.73425 41.0 41.0 41.0 37.0 41.0 16 39.27025 41.0 41.0 41.0 37.0 41.0 17 40.1785 41.0 41.0 41.0 37.0 41.0 18 40.08775 41.0 41.0 41.0 37.0 41.0 19 39.64925 41.0 41.0 41.0 37.0 41.0 20 39.45525 41.0 41.0 41.0 37.0 41.0 21 40.2575 41.0 41.0 41.0 41.0 41.0 22 39.69875 41.0 41.0 41.0 37.0 41.0 23 39.55825 41.0 41.0 41.0 37.0 41.0 24 39.634 41.0 41.0 41.0 37.0 41.0 25 40.11875 41.0 41.0 41.0 37.0 41.0 26 39.8535 41.0 41.0 41.0 37.0 41.0 27 40.00075 41.0 41.0 41.0 37.0 41.0 28 38.838 41.0 41.0 41.0 37.0 41.0 29 39.59825 41.0 41.0 41.0 37.0 41.0 30 39.671 41.0 41.0 41.0 37.0 41.0 31 38.29825 41.0 41.0 41.0 32.0 41.0 32 39.1235 41.0 41.0 41.0 37.0 41.0 33 38.26425 41.0 41.0 41.0 32.0 41.0 34 39.25 41.0 41.0 41.0 37.0 41.0 35 38.885 41.0 41.0 41.0 37.0 41.0 36 39.442 41.0 41.0 41.0 37.0 41.0 37 38.79825 41.0 41.0 41.0 32.0 41.0 38 38.75775 41.0 41.0 41.0 32.0 41.0 39 39.8365 41.0 41.0 41.0 37.0 41.0 40 39.90575 41.0 41.0 41.0 37.0 41.0 41 36.1705 41.0 37.0 41.0 22.0 41.0 42 38.74 41.0 41.0 41.0 32.0 41.0 43 39.788 41.0 41.0 41.0 37.0 41.0 44 38.917 41.0 41.0 41.0 32.0 41.0 45 33.98675 41.0 27.0 41.0 12.0 41.0 46 38.8995 41.0 37.0 41.0 37.0 41.0 47 37.77375 41.0 37.0 41.0 27.0 41.0 48 37.52575 41.0 37.0 41.0 27.0 41.0 49 37.557 41.0 37.0 41.0 27.0 41.0 50 38.451 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 1.0 25 1.0 26 5.0 27 10.0 28 22.0 29 31.0 30 34.0 31 48.0 32 71.0 33 75.0 34 114.0 35 143.0 36 155.0 37 242.0 38 378.0 39 774.0 40 1893.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.22038567493113 9.641873278236915 7.43801652892562 42.69972451790633 2 22.48356095093576 9.534648457258472 36.19119878603945 31.79059180576631 3 22.25 13.15 23.150000000000002 41.449999999999996 4 28.125 19.775000000000002 21.5 30.599999999999998 5 27.500000000000004 23.400000000000002 25.124999999999996 23.974999999999998 6 23.075000000000003 28.249999999999996 25.6 23.075000000000003 7 18.375 23.05 37.375 21.2 8 20.1 23.35 30.7 25.85 9 18.85 20.5 36.975 23.674999999999997 10 23.724999999999998 29.9 25.55 20.825 11 25.7 22.2 24.55 27.55 12 22.25 22.325 28.749999999999996 26.674999999999997 13 22.875 23.275000000000002 26.424999999999997 27.425 14 22.075 24.775 26.474999999999998 26.674999999999997 15 22.075 23.849999999999998 26.8 27.275 16 23.275000000000002 22.25 26.05 28.425 17 23.45 23.75 25.8 27.0 18 23.25 23.35 25.95 27.450000000000003 19 24.099999999999998 23.65 25.324999999999996 26.924999999999997 20 22.95 24.75 24.775 27.525 21 23.25 24.525 25.650000000000002 26.575 22 24.099999999999998 25.35 23.5 27.05 23 23.200000000000003 24.2 26.525 26.075 24 23.674999999999997 23.9 24.675 27.750000000000004 25 23.7 23.974999999999998 24.05 28.275 26 21.9 25.224999999999998 26.974999999999998 25.900000000000002 27 22.35 25.474999999999998 25.275 26.900000000000002 28 24.375 23.825 24.5 27.3 29 24.375 23.95 25.0 26.674999999999997 30 23.525 23.3 26.1 27.075 31 24.099999999999998 24.575 24.6 26.724999999999998 32 25.3 23.575 25.6 25.525 33 22.650000000000002 23.875 26.5 26.974999999999998 34 24.45 23.525 24.725 27.3 35 23.974999999999998 22.85 24.275 28.9 36 21.975 24.925 25.124999999999996 27.975 37 24.175 25.0 23.95 26.875 38 24.075 24.525 24.099999999999998 27.3 39 23.05 23.974999999999998 24.9 28.075 40 24.075 23.075000000000003 25.2 27.650000000000002 41 23.125 23.849999999999998 25.650000000000002 27.375 42 22.8 24.05 25.074999999999996 28.075 43 24.95 22.525000000000002 25.874999999999996 26.650000000000002 44 24.95 24.45 24.675 25.924999999999997 45 23.3 23.25 26.650000000000002 26.8 46 23.849999999999998 23.575 23.775 28.799999999999997 47 24.099999999999998 23.175 25.0 27.725 48 22.425 23.275000000000002 24.925 29.375 49 23.525 23.925 24.4 28.15 50 23.425 24.05 25.825 26.700000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 2.5 22 5.0 23 4.5 24 4.0 25 4.5 26 5.0 27 10.0 28 15.0 29 18.5 30 22.0 31 39.5 32 57.0 33 65.5 34 74.0 35 98.5 36 123.0 37 142.5 38 162.0 39 188.5 40 215.0 41 245.5 42 276.0 43 293.0 44 310.0 45 304.0 46 298.0 47 322.0 48 346.0 49 310.5 50 275.0 51 270.0 52 265.0 53 242.5 54 220.0 55 212.5 56 205.0 57 183.5 58 162.0 59 154.5 60 147.0 61 134.5 62 122.0 63 135.5 64 149.0 65 131.0 66 113.0 67 110.5 68 108.0 69 103.0 70 98.0 71 85.0 72 72.0 73 66.0 74 60.0 75 47.5 76 35.0 77 32.5 78 30.0 79 21.0 80 12.0 81 9.0 82 6.0 83 4.5 84 3.0 85 2.0 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 1.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.27579836368434 90.25 2 4.196357878068092 7.95 3 0.422275006598047 1.2 4 0.026392187912377938 0.1 5 0.052784375824755876 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026392187912377938 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC 10 0.25 TruSeq Adapter, Index 6 (100% over 50bp) CTCAACACAAGTACACACAGTTCCCGTCACGCACCCAGGCCCGCCGCTCC 5 0.125 No Hit GTGCGACGTGGGGCTGGATCTCAGTGGATCGTGGCAGCAAGGCCACTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419406 READS because READLEN < 1 Read 1419406 spots for SRR6322418.sra Written 1419406 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra Rejected 1419400 READS because READLEN < 1 Read 1419400 spots for SRR6322418.sra Written 1419400 spots for SRR6322418.sra SRR ids: ['SRR6322418.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t4ap0vzo SRR6322418.sra spots: 28388006 blocks: [[1, 1419400], [1419401, 2838800], [2838801, 4258200], [4258201, 5677600], [5677601, 7097000], [7097001, 8516400], [8516401, 9935800], [9935801, 11355200], [11355201, 12774600], [12774601, 14194000], [14194001, 15613400], [15613401, 17032800], [17032801, 18452200], [18452201, 19871600], [19871601, 21291000], [21291001, 22710400], [22710401, 24129800], [24129801, 25549200], [25549201, 26968600], [26968601, 28388006]] SRR6322418 file size 3970362 SRR6322418 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322418 SRR6322418_1.fastq Input file: SRR6322418_1.fastq trimmed: SRR6322418-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:15:44 2024 >> started Sat Dec 7 12:15:58 2024 >> done (13.745s) 28388006 reads processed; of these: 70 ( 0.00%) short reads filtered out after trimming by size control 98273 ( 0.35%) empty reads filtered out after trimming by size control 28289663 (99.65%) reads available; of these: 3360 ( 0.01%) trimmed reads available after processing 28286303 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3345 0.01% 50 28286303 99.99% 28289663 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=15.40 fanout-score-rank=7 prefix-density=0.81 prefix-fanout=4.3 sequence=TGCTGCTGCTGCCCACGTCCTTGTTGGCGTTCCTCTCGCTCGTCCTCGGAGGACTGCTCTTCCTGTTGTTGTCGCTCGCTCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=60.47 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.3 sequence=CCGCCGCGCCCTCCTACTCATCGGGGCATGGCGCTCGCCCAGATGGCCGGGTGTGGGTCGCGCGCTTTAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCCCGATTCCATGGCGCGGCTCACCGGAGCAGCCGCGCCGTCCTACCTATTT Started job on | Dec 07 12:16:11 Started mapping on | Dec 07 12:16:11 Finished on | Dec 07 12:16:45 Mapping speed, Million of reads per hour | 2995.38 Number of input reads | 28289663 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 25416194 Uniquely mapped reads % | 89.84% Average mapped length | 49.80 Number of splices: Total | 3405048 Number of splices: Annotated (sjdb) | 3270403 Number of splices: GT/AG | 3353021 Number of splices: GC/AG | 43240 Number of splices: AT/AC | 2755 Number of splices: Non-canonical | 6032 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 769515 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 1674082 % of reads mapped to too many loci | 5.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2103954 2103954 2103954 N_multimapping 769515 769515 769515 N_noFeature 1276712 24922619 1506755 N_ambiguous 287955 1495 24199 UnstrandedReadsAssigned:23851527 PositiveStrandReadsAssigned:492080 NegativeStrandReadsAssigned:23885240 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322418 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322418-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,289,663 reads, 23,700,962 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6322418.ke.tsv 35125 SRR6322418.se.tsv 88098 total ==> SRR6322418.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.00898575 0.00073579 PNS24247 1044 945 170.955 12.3987 PNS24249 1928 1829 546.2 20.4674 PNS24246 1044 945 170.955 12.3987 PNS24248 1044 945 170.955 12.3987 PNS24244 1471 1372 104.925 5.24145 PNS24243 293 194 1 0.353283 KQK14069 1603 1504 267.28 12.1799 KQK14071 474 375 57.054 10.4275 ==> SRR6322418.se.tsv <== BRADI_1g14170v3 350 BRADI_1g53295v3 1832 BRADI_1g59795v3 593 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 591 BRADI_1g74790v3 2 BRADI_1g09890v3 0 BRADI_1g77505v3 360 BRADI_1g48960v3 3 SRR6322418 completed mapping pipeline successfully