Starting /dee2/code/volunteer_pipeline.sh SRR6322419 current disk space = 1543500357632 free memory = 1602685980 SRR6322419 SRAfilesize e14fc9df5bb28cc19b0cf9cc9ccb5dbb SRR6322419.sra SRR6322419.sra file validated SRR6322419 is single end SRR6322419 is conventional basespace SRR6322419 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322419_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.8675 32.0 32.0 32.0 27.0 32.0 2 31.2375 32.0 32.0 32.0 32.0 32.0 3 34.75875 37.0 32.0 37.0 32.0 37.0 4 35.7975 37.0 37.0 37.0 32.0 37.0 5 36.615 37.0 37.0 37.0 37.0 37.0 6 39.97325 41.0 41.0 41.0 37.0 41.0 7 39.7025 41.0 41.0 41.0 37.0 41.0 8 39.6545 41.0 41.0 41.0 37.0 41.0 9 40.0025 41.0 41.0 41.0 37.0 41.0 10 40.42575 41.0 41.0 41.0 41.0 41.0 11 40.1985 41.0 41.0 41.0 41.0 41.0 12 40.34525 41.0 41.0 41.0 41.0 41.0 13 40.2265 41.0 41.0 41.0 41.0 41.0 14 39.7425 41.0 41.0 41.0 37.0 41.0 15 39.6725 41.0 41.0 41.0 37.0 41.0 16 39.22325 41.0 41.0 41.0 37.0 41.0 17 40.14 41.0 41.0 41.0 37.0 41.0 18 40.104 41.0 41.0 41.0 37.0 41.0 19 39.60975 41.0 41.0 41.0 37.0 41.0 20 39.47525 41.0 41.0 41.0 37.0 41.0 21 40.2375 41.0 41.0 41.0 37.0 41.0 22 39.706 41.0 41.0 41.0 37.0 41.0 23 39.716 41.0 41.0 41.0 37.0 41.0 24 39.73275 41.0 41.0 41.0 37.0 41.0 25 40.15725 41.0 41.0 41.0 37.0 41.0 26 39.84875 41.0 41.0 41.0 37.0 41.0 27 39.99475 41.0 41.0 41.0 37.0 41.0 28 38.7705 41.0 41.0 41.0 32.0 41.0 29 39.6075 41.0 41.0 41.0 37.0 41.0 30 39.7435 41.0 41.0 41.0 37.0 41.0 31 38.23725 41.0 41.0 41.0 32.0 41.0 32 39.134 41.0 41.0 41.0 37.0 41.0 33 38.2385 41.0 41.0 41.0 32.0 41.0 34 39.3455 41.0 41.0 41.0 37.0 41.0 35 38.90975 41.0 41.0 41.0 37.0 41.0 36 39.53825 41.0 41.0 41.0 37.0 41.0 37 38.718 41.0 41.0 41.0 32.0 41.0 38 38.70275 41.0 41.0 41.0 32.0 41.0 39 39.71125 41.0 41.0 41.0 37.0 41.0 40 39.911 41.0 41.0 41.0 37.0 41.0 41 35.916 41.0 37.0 41.0 22.0 41.0 42 38.536 41.0 41.0 41.0 32.0 41.0 43 39.67675 41.0 41.0 41.0 37.0 41.0 44 38.7725 41.0 41.0 41.0 32.0 41.0 45 33.50975 41.0 27.0 41.0 12.0 41.0 46 38.71425 41.0 37.0 41.0 32.0 41.0 47 37.4355 41.0 37.0 41.0 27.0 41.0 48 37.50675 41.0 37.0 41.0 27.0 41.0 49 37.439 41.0 37.0 41.0 27.0 41.0 50 38.31 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 0.0 22 0.0 23 0.0 24 2.0 25 0.0 26 5.0 27 14.0 28 19.0 29 25.0 30 47.0 31 44.0 32 70.0 33 74.0 34 123.0 35 115.0 36 187.0 37 243.0 38 394.0 39 927.0 40 1708.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.84484484484484 10.11011011011011 7.332332332332332 37.712712712712715 2 25.266362252663622 10.071029934043633 34.525621511922886 30.136986301369863 3 20.974999999999998 15.375 24.15 39.5 4 27.175 19.925 23.275000000000002 29.625 5 27.224999999999998 24.95 25.025 22.8 6 24.099999999999998 28.225 23.974999999999998 23.7 7 18.625 24.0 37.025000000000006 20.349999999999998 8 20.474999999999998 22.0 30.625000000000004 26.900000000000002 9 20.5 20.05 32.85 26.6 10 21.525 31.574999999999996 25.825 21.075 11 24.975 23.275000000000002 24.05 27.700000000000003 12 23.75 21.45 26.55 28.249999999999996 13 23.799999999999997 23.549999999999997 27.900000000000002 24.75 14 23.200000000000003 24.45 25.924999999999997 26.424999999999997 15 22.25 23.474999999999998 26.375 27.900000000000002 16 25.0 23.0 24.8 27.200000000000003 17 24.425 23.724999999999998 26.275 25.575 18 22.975 24.125 25.124999999999996 27.775 19 22.85 24.125 25.4 27.625 20 23.35 23.799999999999997 26.275 26.575 21 23.474999999999998 23.175 25.124999999999996 28.225 22 23.45 24.925 24.675 26.950000000000003 23 23.275000000000002 24.0 25.275 27.450000000000003 24 21.675 23.925 27.800000000000004 26.6 25 24.349999999999998 23.275000000000002 25.650000000000002 26.724999999999998 26 23.3 22.875 26.674999999999997 27.150000000000002 27 23.474999999999998 23.65 25.85 27.025 28 24.575 24.325 22.55 28.549999999999997 29 25.1 24.025 24.625 26.25 30 23.200000000000003 22.325 25.525 28.95 31 24.575 23.425 24.375 27.625 32 24.925 23.400000000000002 24.725 26.950000000000003 33 22.900000000000002 22.475 25.424999999999997 29.2 34 24.8 25.15 23.150000000000002 26.900000000000002 35 24.425 23.799999999999997 25.575 26.200000000000003 36 24.05 22.2 24.75 28.999999999999996 37 23.825 24.975 23.35 27.85 38 24.95 24.125 24.7 26.224999999999998 39 23.825 22.675 24.55 28.95 40 23.1 24.125 24.6 28.175 41 24.15 23.65 25.324999999999996 26.875 42 22.575 23.9 24.2 29.325000000000003 43 24.7 23.200000000000003 25.074999999999996 27.025 44 23.325000000000003 23.175 25.825 27.675 45 24.224999999999998 23.25 24.55 27.975 46 24.6 23.625 23.674999999999997 28.1 47 24.9 23.525 25.0 26.575 48 23.674999999999997 24.0 25.2 27.125 49 24.45 23.925 24.95 26.674999999999997 50 24.6 23.875 24.15 27.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 1.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 3.0 26 3.0 27 7.0 28 11.0 29 15.5 30 20.0 31 32.5 32 45.0 33 62.0 34 79.0 35 104.5 36 130.0 37 152.5 38 175.0 39 189.0 40 203.0 41 235.0 42 267.0 43 298.0 44 329.0 45 308.5 46 288.0 47 302.5 48 317.0 49 296.5 50 276.0 51 267.5 52 259.0 53 239.0 54 219.0 55 205.5 56 192.0 57 176.0 58 160.0 59 150.5 60 141.0 61 150.0 62 159.0 63 137.5 64 116.0 65 120.5 66 125.0 67 121.5 68 118.0 69 115.0 70 112.0 71 94.0 72 76.0 73 67.5 74 59.0 75 55.5 76 52.0 77 40.5 78 29.0 79 20.5 80 12.0 81 11.0 82 10.0 83 8.0 84 6.0 85 3.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 1.4500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7919498170413 91.625 2 3.9205436487192893 7.5 3 0.23523261892315736 0.675 4 0.052273915316257184 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410295 READS because READLEN < 1 Read 1410295 spots for SRR6322419.sra Written 1410295 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra Rejected 1410291 READS because READLEN < 1 Read 1410291 spots for SRR6322419.sra Written 1410291 spots for SRR6322419.sra SRR ids: ['SRR6322419.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tsjjp5k3 SRR6322419.sra spots: 28205824 blocks: [[1, 1410291], [1410292, 2820582], [2820583, 4230873], [4230874, 5641164], [5641165, 7051455], [7051456, 8461746], [8461747, 9872037], [9872038, 11282328], [11282329, 12692619], [12692620, 14102910], [14102911, 15513201], [15513202, 16923492], [16923493, 18333783], [18333784, 19744074], [19744075, 21154365], [21154366, 22564656], [22564657, 23974947], [23974948, 25385238], [25385239, 26795529], [26795530, 28205824]] SRR6322419 file size 3944743 SRR6322419 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322419 SRR6322419_1.fastq Input file: SRR6322419_1.fastq trimmed: SRR6322419-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:36:53 2024 >> started Sat Dec 7 10:37:06 2024 >> done (13.259s) 28205824 reads processed; of these: 90 ( 0.00%) short reads filtered out after trimming by size control 24992 ( 0.09%) empty reads filtered out after trimming by size control 28180742 (99.91%) reads available; of these: 3016 ( 0.01%) trimmed reads available after processing 28177726 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3008 0.01% 50 28177726 99.99% 28180742 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=12.69 fanout-score-rank=5 prefix-density=1.13 prefix-fanout=3.8 sequence=TGCTGCTGCTGCCCACGTCCTTGTTGGCGTTCCTCTCGCTCGTCCTCGGAGGACTGCTCTTCCTGTTGTTGTCGCTCGCTCTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=75.09 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.8 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGG Started job on | Dec 07 10:37:31 Started mapping on | Dec 07 10:37:31 Finished on | Dec 07 10:38:09 Mapping speed, Million of reads per hour | 2669.75 Number of input reads | 28180742 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 25916575 Uniquely mapped reads % | 91.97% Average mapped length | 49.80 Number of splices: Total | 3458220 Number of splices: Annotated (sjdb) | 3337301 Number of splices: GT/AG | 3406564 Number of splices: GC/AG | 42731 Number of splices: AT/AC | 2651 Number of splices: Non-canonical | 6274 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 793648 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 1172572 % of reads mapped to too many loci | 4.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1470519 1470519 1470519 N_multimapping 793648 793648 793648 N_noFeature 1206105 25467453 1410903 N_ambiguous 267010 1549 22427 UnstrandedReadsAssigned:24443460 PositiveStrandReadsAssigned:447573 NegativeStrandReadsAssigned:24483245 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322419 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322419-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,180,742 reads, 24,323,149 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52973 SRR6322419.ke.tsv 35125 SRR6322419.se.tsv 88098 total ==> SRR6322419.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 124.547 9.01453 PNS24249 1928 1829 646.487 24.1762 PNS24246 1044 945 124.547 9.01453 PNS24248 1044 945 124.547 9.01453 PNS24244 1471 1372 20.8732 1.04058 PNS24243 293 194 0 0 KQK14069 1603 1504 324.881 14.7747 KQK14071 474 375 63.7929 11.6355 ==> SRR6322419.se.tsv <== BRADI_1g14170v3 412 BRADI_1g53295v3 1890 BRADI_1g59795v3 662 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 675 BRADI_1g74790v3 2 BRADI_1g09890v3 0 BRADI_1g77505v3 340 BRADI_1g48960v3 0 SRR6322419 completed mapping pipeline successfully