Starting /dee2/code/volunteer_pipeline.sh SRR6322420 current disk space = 1543498768384 free memory = 1601563460 SRR6322420 SRAfilesize 0dfa0c696da2897d347068978cce26e2 SRR6322420.sra SRR6322420.sra file validated SRR6322420 is single end SRR6322420 is conventional basespace SRR6322420 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.84 32.0 32.0 32.0 27.0 32.0 2 31.30375 32.0 32.0 32.0 32.0 32.0 3 34.6525 37.0 32.0 37.0 32.0 37.0 4 35.63125 37.0 37.0 37.0 32.0 37.0 5 36.64375 37.0 37.0 37.0 37.0 37.0 6 40.0305 41.0 41.0 41.0 37.0 41.0 7 39.70875 41.0 41.0 41.0 37.0 41.0 8 39.61725 41.0 41.0 41.0 37.0 41.0 9 39.90675 41.0 41.0 41.0 37.0 41.0 10 40.3915 41.0 41.0 41.0 41.0 41.0 11 40.1085 41.0 41.0 41.0 37.0 41.0 12 40.3445 41.0 41.0 41.0 41.0 41.0 13 40.237 41.0 41.0 41.0 41.0 41.0 14 39.65725 41.0 41.0 41.0 37.0 41.0 15 39.507 41.0 41.0 41.0 37.0 41.0 16 39.17225 41.0 41.0 41.0 37.0 41.0 17 40.21275 41.0 41.0 41.0 37.0 41.0 18 40.084 41.0 41.0 41.0 37.0 41.0 19 39.48575 41.0 41.0 41.0 37.0 41.0 20 39.307 41.0 41.0 41.0 37.0 41.0 21 40.16525 41.0 41.0 41.0 37.0 41.0 22 39.79675 41.0 41.0 41.0 37.0 41.0 23 39.69625 41.0 41.0 41.0 37.0 41.0 24 39.59 41.0 41.0 41.0 37.0 41.0 25 40.11475 41.0 41.0 41.0 41.0 41.0 26 39.75025 41.0 41.0 41.0 37.0 41.0 27 39.97225 41.0 41.0 41.0 37.0 41.0 28 38.53675 41.0 41.0 41.0 32.0 41.0 29 39.52775 41.0 41.0 41.0 37.0 41.0 30 39.61225 41.0 41.0 41.0 37.0 41.0 31 38.13625 41.0 41.0 41.0 32.0 41.0 32 39.0875 41.0 41.0 41.0 37.0 41.0 33 38.22975 41.0 41.0 41.0 32.0 41.0 34 39.27375 41.0 41.0 41.0 37.0 41.0 35 38.681 41.0 41.0 41.0 32.0 41.0 36 39.4975 41.0 41.0 41.0 37.0 41.0 37 38.7505 41.0 41.0 41.0 32.0 41.0 38 38.6895 41.0 41.0 41.0 32.0 41.0 39 39.77925 41.0 41.0 41.0 37.0 41.0 40 39.96225 41.0 41.0 41.0 37.0 41.0 41 35.87025 41.0 37.0 41.0 12.0 41.0 42 38.4595 41.0 41.0 41.0 32.0 41.0 43 39.72175 41.0 41.0 41.0 37.0 41.0 44 38.7545 41.0 41.0 41.0 32.0 41.0 45 33.53725 41.0 27.0 41.0 12.0 41.0 46 38.74275 41.0 37.0 41.0 32.0 41.0 47 37.549 41.0 37.0 41.0 27.0 41.0 48 37.201 41.0 37.0 41.0 27.0 41.0 49 37.42875 41.0 37.0 41.0 27.0 41.0 50 38.30125 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 8.0 26 6.0 27 14.0 28 13.0 29 31.0 30 50.0 31 50.0 32 84.0 33 82.0 34 114.0 35 140.0 36 164.0 37 248.0 38 379.0 39 833.0 40 1782.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.06029522141606 10.70803102326745 5.854390793094821 36.37728296222167 2 23.197571464710347 10.144194282823173 36.75689349860865 29.90134075385783 3 21.224999999999998 15.4 25.275 38.1 4 27.525 20.549999999999997 22.175 29.75 5 27.175 24.325 25.924999999999997 22.575 6 23.724999999999998 27.575 24.7 24.0 7 18.7 24.275 37.625 19.400000000000002 8 19.400000000000002 23.724999999999998 30.25 26.625 9 18.925 19.5 35.699999999999996 25.874999999999996 10 21.575 30.75 27.05 20.625 11 26.875 23.075000000000003 22.2 27.85 12 23.425 21.425 27.325 27.825 13 23.35 25.424999999999997 26.450000000000003 24.775 14 23.9 23.674999999999997 25.7 26.724999999999998 15 23.35 23.95 25.7 27.0 16 22.95 22.975 25.4 28.675 17 23.525 24.575 26.125 25.775 18 22.675 24.025 26.25 27.05 19 25.224999999999998 23.525 24.925 26.325 20 24.075 24.775 23.75 27.400000000000002 21 23.375 24.175 26.25 26.200000000000003 22 24.3 24.45 24.8 26.450000000000003 23 24.775 23.674999999999997 25.2 26.35 24 23.974999999999998 23.025000000000002 25.074999999999996 27.925 25 23.375 24.725 24.15 27.750000000000004 26 23.95 24.7 25.174999999999997 26.174999999999997 27 23.625 23.599999999999998 26.5 26.275 28 24.05 24.325 24.875 26.75 29 23.35 25.15 25.074999999999996 26.424999999999997 30 23.125 24.8 25.4 26.674999999999997 31 24.175 23.45 24.425 27.950000000000003 32 24.325 24.349999999999998 25.45 25.874999999999996 33 22.775000000000002 22.225 25.674999999999997 29.325000000000003 34 23.150000000000002 24.775 25.224999999999998 26.85 35 24.4 23.375 26.325 25.900000000000002 36 23.425 23.674999999999997 24.8 28.1 37 24.525 23.200000000000003 25.624999999999996 26.650000000000002 38 23.225 24.65 25.85 26.275 39 24.15 23.799999999999997 24.975 27.075 40 24.625 23.474999999999998 25.074999999999996 26.825 41 22.875 24.55 25.575 27.0 42 23.5 23.425 25.224999999999998 27.85 43 24.325 23.200000000000003 24.85 27.625 44 23.799999999999997 23.775 24.85 27.575 45 24.15 23.400000000000002 25.900000000000002 26.55 46 24.825 22.775000000000002 25.624999999999996 26.775 47 22.875 24.175 25.275 27.675 48 23.775 23.45 25.575 27.200000000000003 49 24.3 23.925 24.474999999999998 27.3 50 22.875 23.95 25.0 28.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 3.5 24 6.0 25 7.0 26 8.0 27 13.0 28 18.0 29 27.5 30 37.0 31 37.0 32 37.0 33 59.0 34 81.0 35 106.0 36 131.0 37 168.0 38 205.0 39 206.0 40 207.0 41 235.0 42 263.0 43 298.5 44 334.0 45 327.0 46 320.0 47 310.5 48 301.0 49 289.5 50 278.0 51 263.0 52 248.0 53 221.0 54 194.0 55 194.5 56 195.0 57 173.5 58 152.0 59 149.0 60 146.0 61 143.0 62 140.0 63 137.0 64 134.0 65 125.0 66 116.0 67 106.5 68 97.0 69 93.5 70 90.0 71 88.5 72 87.0 73 74.0 74 61.0 75 56.5 76 52.0 77 42.5 78 33.0 79 21.5 80 10.0 81 10.5 82 11.0 83 6.0 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 1.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.72402938090241 91.225 2 3.987408184679958 7.6 3 0.2098635886673662 0.6 4 0.026232948583420776 0.1 5 0.026232948583420776 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026232948583420776 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 14 0.35000000000000003 TruSeq Adapter, Index 4 (100% over 50bp) CTCAACACAAGTACACACAGTTCCCGTCACGCACCCAGGCCCGCCGCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476821 READS because READLEN < 1 Read 1476821 spots for SRR6322420.sra Written 1476821 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra Rejected 1476805 READS because READLEN < 1 Read 1476805 spots for SRR6322420.sra Written 1476805 spots for SRR6322420.sra SRR ids: ['SRR6322420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a7k6tyw3 SRR6322420.sra spots: 29536116 blocks: [[1, 1476805], [1476806, 2953610], [2953611, 4430415], [4430416, 5907220], [5907221, 7384025], [7384026, 8860830], [8860831, 10337635], [10337636, 11814440], [11814441, 13291245], [13291246, 14768050], [14768051, 16244855], [16244856, 17721660], [17721661, 19198465], [19198466, 20675270], [20675271, 22152075], [22152076, 23628880], [23628881, 25105685], [25105686, 26582490], [26582491, 28059295], [28059296, 29536116]] SRR6322420 file size 4131815 SRR6322420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322420 SRR6322420_1.fastq Input file: SRR6322420_1.fastq trimmed: SRR6322420-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:38:11 2024 >> started Sat Dec 7 10:38:32 2024 >> done (21.434s) 29536116 reads processed; of these: 115 ( 0.00%) short reads filtered out after trimming by size control 207152 ( 0.70%) empty reads filtered out after trimming by size control 29328849 (99.30%) reads available; of these: 3373 ( 0.01%) trimmed reads available after processing 29325476 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3358 0.01% 50 29325476 99.99% 29328849 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=13.25 fanout-score-rank=7 prefix-density=1.00 prefix-fanout=3.9 sequence=TGCTGCTGCTGCCCACGTCCTTGTTGGCGTTCCTCTCGCTCGTCCTCGGAGGACTGCTCTTCCTGTTGTTGTCGCTCGCTCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=91.17 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=4.2 sequence=GCCGCCGCCAGCTCCAGCCTCATGCGCTTTGCTCTGGATGGCCTGCCCAGCCTGCTGCGTCTTGTGGCCCGCCGCCGCG Started job on | Dec 07 10:38:55 Started mapping on | Dec 07 10:38:55 Finished on | Dec 07 10:39:42 Mapping speed, Million of reads per hour | 2246.47 Number of input reads | 29328849 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 27863385 Uniquely mapped reads % | 95.00% Average mapped length | 49.80 Number of splices: Total | 3742269 Number of splices: Annotated (sjdb) | 3614792 Number of splices: GT/AG | 3689542 Number of splices: GC/AG | 43380 Number of splices: AT/AC | 2838 Number of splices: Non-canonical | 6509 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 797201 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 438443 % of reads mapped to too many loci | 1.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 668263 668263 668263 N_multimapping 797201 797201 797201 N_noFeature 1353387 27365060 1554241 N_ambiguous 321074 2234 23439 UnstrandedReadsAssigned:26188924 PositiveStrandReadsAssigned:496091 NegativeStrandReadsAssigned:26285705 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322420 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322420-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,328,849 reads, 26,066,482 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,349 rounds 52973 SRR6322420.ke.tsv 35125 SRR6322420.se.tsv 88098 total ==> SRR6322420.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.0614258 0.00469225 PNS24247 1044 945 110.504 7.47653 PNS24249 1928 1829 427.994 14.9616 PNS24246 1044 945 110.504 7.47653 PNS24248 1044 945 110.504 7.47653 PNS24244 1471 1372 38.434 1.79109 PNS24243 293 194 0 0 KQK14069 1603 1504 26.643 1.13264 KQK14071 474 375 9.39195 1.60133 ==> SRR6322420.se.tsv <== BRADI_1g14170v3 36 BRADI_1g53295v3 2010 BRADI_1g59795v3 631 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 2039 BRADI_1g74790v3 5 BRADI_1g09890v3 0 BRADI_1g77505v3 411 BRADI_1g48960v3 0 SRR6322420 completed mapping pipeline successfully