Starting /dee2/code/volunteer_pipeline.sh SRR6322421 current disk space = 1543502032896 free memory = 1602933060 SRR6322421 SRAfilesize a9f8a4f2f2a1d7454494e35437facf04 SRR6322421.sra SRR6322421.sra file validated SRR6322421 is single end SRR6322421 is conventional basespace SRR6322421 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.88 32.0 32.0 32.0 27.0 32.0 2 31.1625 32.0 32.0 32.0 32.0 32.0 3 34.75625 37.0 32.0 37.0 32.0 37.0 4 35.645 37.0 37.0 37.0 32.0 37.0 5 36.6625 37.0 37.0 37.0 37.0 37.0 6 40.0055 41.0 41.0 41.0 37.0 41.0 7 39.71525 41.0 41.0 41.0 37.0 41.0 8 39.6415 41.0 41.0 41.0 37.0 41.0 9 40.0475 41.0 41.0 41.0 37.0 41.0 10 40.45025 41.0 41.0 41.0 41.0 41.0 11 40.2745 41.0 41.0 41.0 41.0 41.0 12 40.3915 41.0 41.0 41.0 41.0 41.0 13 40.215 41.0 41.0 41.0 41.0 41.0 14 39.651 41.0 41.0 41.0 37.0 41.0 15 39.62425 41.0 41.0 41.0 37.0 41.0 16 39.12 41.0 41.0 41.0 37.0 41.0 17 40.13625 41.0 41.0 41.0 37.0 41.0 18 40.1065 41.0 41.0 41.0 37.0 41.0 19 39.567 41.0 41.0 41.0 37.0 41.0 20 39.4035 41.0 41.0 41.0 37.0 41.0 21 40.28575 41.0 41.0 41.0 41.0 41.0 22 39.75075 41.0 41.0 41.0 37.0 41.0 23 39.56925 41.0 41.0 41.0 37.0 41.0 24 39.69025 41.0 41.0 41.0 37.0 41.0 25 40.1685 41.0 41.0 41.0 37.0 41.0 26 39.857 41.0 41.0 41.0 37.0 41.0 27 39.95675 41.0 41.0 41.0 37.0 41.0 28 38.57125 41.0 41.0 41.0 32.0 41.0 29 39.73525 41.0 41.0 41.0 37.0 41.0 30 39.713 41.0 41.0 41.0 37.0 41.0 31 38.26625 41.0 41.0 41.0 32.0 41.0 32 39.14325 41.0 41.0 41.0 37.0 41.0 33 38.10975 41.0 41.0 41.0 27.0 41.0 34 39.30375 41.0 41.0 41.0 37.0 41.0 35 38.79125 41.0 41.0 41.0 32.0 41.0 36 39.47875 41.0 41.0 41.0 37.0 41.0 37 38.749 41.0 41.0 41.0 32.0 41.0 38 38.63775 41.0 41.0 41.0 32.0 41.0 39 39.8325 41.0 41.0 41.0 37.0 41.0 40 39.977 41.0 41.0 41.0 37.0 41.0 41 35.8155 41.0 37.0 41.0 22.0 41.0 42 38.51575 41.0 41.0 41.0 32.0 41.0 43 39.7855 41.0 41.0 41.0 37.0 41.0 44 38.7865 41.0 41.0 41.0 32.0 41.0 45 33.28775 41.0 27.0 41.0 12.0 41.0 46 38.8005 41.0 37.0 41.0 32.0 41.0 47 37.35575 41.0 37.0 41.0 27.0 41.0 48 37.28175 41.0 37.0 41.0 27.0 41.0 49 37.458 41.0 37.0 41.0 27.0 41.0 50 38.358 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 2.0 26 7.0 27 15.0 28 14.0 29 31.0 30 32.0 31 54.0 32 68.0 33 81.0 34 122.0 35 110.0 36 198.0 37 281.0 38 389.0 39 898.0 40 1696.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.83745936484121 11.877969492373094 5.951487871967992 32.3330832708177 2 25.738289205702646 10.590631364562118 35.31059063136456 28.36048879837067 3 21.9 15.975 23.575 38.550000000000004 4 26.450000000000003 22.95 21.425 29.175 5 27.700000000000003 26.55 22.625 23.125 6 24.6 29.349999999999998 22.825 23.225 7 19.5 24.9 35.725 19.875 8 20.549999999999997 22.425 30.075000000000003 26.950000000000003 9 20.225 21.8 31.75 26.224999999999998 10 21.825 32.15 24.95 21.075 11 26.474999999999998 23.200000000000003 22.05 28.275 12 23.875 21.65 26.525 27.950000000000003 13 23.825 24.325 25.45 26.400000000000002 14 23.799999999999997 23.825 25.424999999999997 26.950000000000003 15 23.95 24.7 25.624999999999996 25.724999999999998 16 25.575 23.95 24.275 26.200000000000003 17 25.75 24.099999999999998 24.224999999999998 25.924999999999997 18 23.875 25.974999999999998 23.724999999999998 26.424999999999997 19 26.1 23.95 24.375 25.575 20 25.6 22.575 25.275 26.55 21 23.7 25.7 24.7 25.900000000000002 22 24.099999999999998 24.775 23.974999999999998 27.150000000000002 23 24.224999999999998 25.924999999999997 23.9 25.95 24 23.775 25.25 24.525 26.450000000000003 25 25.124999999999996 25.45 23.150000000000002 26.275 26 24.775 24.675 24.75 25.8 27 23.9 23.9 25.374999999999996 26.825 28 26.0 23.974999999999998 23.35 26.674999999999997 29 24.25 24.7 25.074999999999996 25.974999999999998 30 23.025000000000002 24.825 24.55 27.6 31 25.35 25.35 24.425 24.875 32 25.1 23.575 24.425 26.900000000000002 33 22.725 23.799999999999997 26.5 26.974999999999998 34 25.374999999999996 23.825 23.5 27.3 35 24.474999999999998 24.95 24.224999999999998 26.35 36 24.575 23.25 24.925 27.250000000000004 37 24.474999999999998 24.3 24.425 26.8 38 25.924999999999997 23.849999999999998 25.85 24.375 39 23.925 23.150000000000002 24.425 28.499999999999996 40 25.4 25.05 23.775 25.775 41 26.075 23.525 24.85 25.55 42 24.175 24.7 23.75 27.375 43 25.074999999999996 24.175 23.225 27.525 44 24.224999999999998 24.9 24.575 26.3 45 25.074999999999996 23.0 25.8 26.125 46 25.825 22.650000000000002 23.875 27.650000000000002 47 26.0 24.175 24.45 25.374999999999996 48 24.825 23.474999999999998 23.7 28.000000000000004 49 24.7 23.775 24.2 27.325 50 25.5 23.674999999999997 24.975 25.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 4.0 24 6.0 25 8.0 26 10.0 27 13.5 28 17.0 29 21.0 30 25.0 31 39.5 32 54.0 33 74.5 34 95.0 35 106.5 36 118.0 37 145.0 38 172.0 39 179.0 40 186.0 41 212.5 42 239.0 43 257.5 44 276.0 45 282.5 46 289.0 47 302.0 48 315.0 49 303.5 50 292.0 51 283.5 52 275.0 53 261.0 54 247.0 55 228.5 56 210.0 57 188.5 58 167.0 59 165.0 60 163.0 61 160.5 62 158.0 63 151.5 64 145.0 65 130.0 66 115.0 67 106.0 68 97.0 69 88.0 70 79.0 71 77.5 72 76.0 73 61.5 74 47.0 75 47.0 76 47.0 77 38.5 78 30.0 79 26.5 80 23.0 81 16.5 82 10.0 83 10.0 84 10.0 85 6.5 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.7999999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.95827900912647 92.0 2 3.8331160365058667 7.35 3 0.18252933507170796 0.525 4 0.0 0.0 5 0.02607561929595828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCGACGTGGGGCTGGATCTCAGTGGATCGTGGCAGCAAGGCCACTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464018 READS because READLEN < 1 Read 1464018 spots for SRR6322421.sra Written 1464018 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra Rejected 1464010 READS because READLEN < 1 Read 1464010 spots for SRR6322421.sra Written 1464010 spots for SRR6322421.sra SRR ids: ['SRR6322421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j4y_gane SRR6322421.sra spots: 29280208 blocks: [[1, 1464010], [1464011, 2928020], [2928021, 4392030], [4392031, 5856040], [5856041, 7320050], [7320051, 8784060], [8784061, 10248070], [10248071, 11712080], [11712081, 13176090], [13176091, 14640100], [14640101, 16104110], [16104111, 17568120], [17568121, 19032130], [19032131, 20496140], [20496141, 21960150], [21960151, 23424160], [23424161, 24888170], [24888171, 26352180], [26352181, 27816190], [27816191, 29280208]] SRR6322421 file size 4095828 SRR6322421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322421 SRR6322421_1.fastq Input file: SRR6322421_1.fastq trimmed: SRR6322421-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:39:31 2024 >> started Sat Dec 7 10:39:48 2024 >> done (16.680s) 29280208 reads processed; of these: 172 ( 0.00%) short reads filtered out after trimming by size control 39125 ( 0.13%) empty reads filtered out after trimming by size control 29240911 (99.87%) reads available; of these: 3160 ( 0.01%) trimmed reads available after processing 29237751 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3154 0.01% 50 29237751 99.99% 29240911 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=16 prefix-density=0.14 prefix-fanout=2.0 sequence=GCACTCAGCACAGCACACTGCTGAAACACACACGGAACACAGACACCGACACACTCGCACACATTCAGAGAGAGACATCAAGATCGATCGGTCCAAGGGCCCTGGATGATACATCAGCATATCACCCGGCTGGGCCGTCCATCCGGCCGCATCTAGCACTTTGGGACGGGGATGCCGCAGGATGCGACGGTCTGGCGAGCGTAGGGGCTGCTGATGTAGCGGCCGTAGTTGGGGTCCTTGGCGTACTGGCACAGACAACCCTGCTGCGCCCTCAGGTTGCTGCAGCACTCGGCGCTCGGCGGCGACCCCGACGTGATCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=71.12 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.7 sequence=CCGCCGCCGCCA Started job on | Dec 07 10:40:01 Started mapping on | Dec 07 10:40:01 Finished on | Dec 07 10:40:28 Mapping speed, Million of reads per hour | 3898.79 Number of input reads | 29240911 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26850426 Uniquely mapped reads % | 91.82% Average mapped length | 49.79 Number of splices: Total | 3612824 Number of splices: Annotated (sjdb) | 3502353 Number of splices: GT/AG | 3566036 Number of splices: GC/AG | 40435 Number of splices: AT/AC | 2143 Number of splices: Non-canonical | 4210 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 926655 % of reads mapped to multiple loci | 3.17% Number of reads mapped to too many loci | 1240008 % of reads mapped to too many loci | 4.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1463830 1463830 1463830 N_multimapping 926655 926655 926655 N_noFeature 953092 25757239 1116123 N_ambiguous 962928 1893 33424 UnstrandedReadsAssigned:24934406 PositiveStrandReadsAssigned:1091294 NegativeStrandReadsAssigned:25700879 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322421 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322421-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,240,911 reads, 25,551,913 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6322421.ke.tsv 35125 SRR6322421.se.tsv 88098 total ==> SRR6322421.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 106.17 7.97874 PNS24247 1044 945 31.0482 2.06663 PNS24249 1928 1829 330.686 11.3726 PNS24246 1044 945 31.0482 2.06663 PNS24248 1044 945 31.0482 2.06663 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 2309.97 96.609 KQK14071 474 375 280.681 47.0804 ==> SRR6322421.se.tsv <== BRADI_1g14170v3 2781 BRADI_1g53295v3 199 BRADI_1g59795v3 330 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 1661 BRADI_1g74790v3 92 BRADI_1g09890v3 41 BRADI_1g77505v3 505 BRADI_1g48960v3 0 SRR6322421 completed mapping pipeline successfully