Starting /dee2/code/volunteer_pipeline.sh SRR6322422 current disk space = 1543143342080 free memory = 1606486492 SRR6322422 SRAfilesize 27d99cac9e21b755b80d388ddcbacbcb SRR6322422.sra SRR6322422.sra file validated SRR6322422 is single end SRR6322422 is conventional basespace SRR6322422 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51125 32.0 32.0 32.0 32.0 32.0 2 29.9075 32.0 32.0 32.0 27.0 32.0 3 35.3075 37.0 32.0 37.0 32.0 37.0 4 34.39375 37.0 37.0 37.0 27.0 37.0 5 35.705 37.0 37.0 37.0 32.0 37.0 6 39.96925 41.0 41.0 41.0 37.0 41.0 7 40.232 41.0 41.0 41.0 37.0 41.0 8 40.388 41.0 41.0 41.0 41.0 41.0 9 40.0155 41.0 41.0 41.0 37.0 41.0 10 40.2055 41.0 41.0 41.0 37.0 41.0 11 38.63225 41.0 41.0 41.0 32.0 41.0 12 39.94525 41.0 41.0 41.0 37.0 41.0 13 40.1615 41.0 41.0 41.0 37.0 41.0 14 40.357 41.0 41.0 41.0 41.0 41.0 15 39.5145 41.0 41.0 41.0 37.0 41.0 16 39.397 41.0 41.0 41.0 37.0 41.0 17 40.264 41.0 41.0 41.0 37.0 41.0 18 40.345 41.0 41.0 41.0 41.0 41.0 19 40.24125 41.0 41.0 41.0 41.0 41.0 20 39.85775 41.0 41.0 41.0 37.0 41.0 21 37.808 41.0 37.0 41.0 27.0 41.0 22 39.67625 41.0 41.0 41.0 37.0 41.0 23 37.74375 41.0 37.0 41.0 27.0 41.0 24 39.53975 41.0 41.0 41.0 37.0 41.0 25 39.5665 41.0 41.0 41.0 37.0 41.0 26 38.15975 41.0 37.0 41.0 32.0 41.0 27 32.8315 37.0 27.0 41.0 12.0 41.0 28 34.824 41.0 32.0 41.0 22.0 41.0 29 38.752 41.0 37.0 41.0 32.0 41.0 30 39.21425 41.0 41.0 41.0 37.0 41.0 31 38.988 41.0 41.0 41.0 37.0 41.0 32 38.49475 41.0 41.0 41.0 32.0 41.0 33 32.13875 37.0 27.0 41.0 12.0 41.0 34 37.3685 41.0 37.0 41.0 27.0 41.0 35 38.8955 41.0 41.0 41.0 37.0 41.0 36 39.757 41.0 41.0 41.0 37.0 41.0 37 39.7785 41.0 41.0 41.0 37.0 41.0 38 38.3995 41.0 41.0 41.0 32.0 41.0 39 38.2965 41.0 41.0 41.0 32.0 41.0 40 38.9025 41.0 41.0 41.0 37.0 41.0 41 39.32625 41.0 41.0 41.0 37.0 41.0 42 39.451 41.0 41.0 41.0 37.0 41.0 43 39.6085 41.0 41.0 41.0 37.0 41.0 44 38.77425 41.0 41.0 41.0 32.0 41.0 45 38.93175 41.0 41.0 41.0 37.0 41.0 46 32.23825 37.0 27.0 41.0 12.0 41.0 47 36.741 41.0 37.0 41.0 27.0 41.0 48 37.36525 41.0 37.0 41.0 27.0 41.0 49 39.3845 41.0 41.0 41.0 37.0 41.0 50 39.64275 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 5.0 26 6.0 27 14.0 28 18.0 29 38.0 30 39.0 31 61.0 32 69.0 33 94.0 34 123.0 35 180.0 36 261.0 37 376.0 38 618.0 39 1061.0 40 1033.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.692846423211606 9.729864932466233 6.878439219609805 47.69884942471236 2 22.851871375856618 9.093305218766472 41.72377438060095 26.33104902477596 3 23.025000000000002 13.225000000000001 23.549999999999997 40.2 4 28.249999999999996 20.225 21.9 29.625 5 28.299999999999997 25.624999999999996 25.25 20.825 6 23.925 28.9 24.925 22.25 7 18.9 24.95 38.824999999999996 17.325 8 19.6 24.0 32.95 23.45 9 19.1 20.275000000000002 36.85 23.775 10 20.674999999999997 32.475 26.8 20.05 11 25.3 25.525 23.275000000000002 25.900000000000002 12 23.549999999999997 22.975 27.224999999999998 26.25 13 24.0 24.525 28.549999999999997 22.925 14 22.85 25.424999999999997 26.674999999999997 25.05 15 22.625 23.95 27.925 25.5 16 23.5 23.925 25.825 26.75 17 24.025 25.674999999999997 26.400000000000002 23.9 18 23.575 24.525 25.85 26.05 19 23.474999999999998 24.675 26.05 25.8 20 24.975 24.525 27.500000000000004 23.0 21 24.0 24.625 25.7 25.674999999999997 22 22.925 25.124999999999996 26.275 25.674999999999997 23 24.3 25.275 24.675 25.75 24 22.225 24.45 26.724999999999998 26.6 25 23.125 24.8 25.424999999999997 26.650000000000002 26 22.975 24.25 26.375 26.400000000000002 27 24.9 23.525 24.675 26.900000000000002 28 23.425 25.5 26.0 25.074999999999996 29 25.624999999999996 25.324999999999996 25.724999999999998 23.325000000000003 30 22.95 24.625 25.05 27.375 31 22.625 25.924999999999997 24.975 26.474999999999998 32 22.75 25.474999999999998 26.825 24.95 33 25.474999999999998 23.200000000000003 24.95 26.375 34 25.275 24.9 24.75 25.074999999999996 35 24.05 25.174999999999997 26.325 24.45 36 23.799999999999997 24.025 25.525 26.650000000000002 37 24.675 24.825 24.95 25.55 38 24.2 25.124999999999996 27.150000000000002 23.525 39 24.175 22.5 26.224999999999998 27.1 40 23.65 24.675 23.75 27.925 41 23.775 25.2 25.424999999999997 25.6 42 23.549999999999997 24.5 25.0 26.950000000000003 43 24.3 25.6 24.725 25.374999999999996 44 24.375 25.124999999999996 25.275 25.224999999999998 45 22.975 25.025 25.025 26.974999999999998 46 26.025 24.85 22.45 26.674999999999997 47 22.875 24.85 27.200000000000003 25.074999999999996 48 23.625 23.375 25.55 27.450000000000003 49 23.825 25.85 24.625 25.7 50 24.0 25.224999999999998 24.8 25.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.5 22 3.0 23 4.0 24 5.0 25 5.0 26 5.0 27 8.5 28 12.0 29 21.0 30 30.0 31 40.5 32 51.0 33 79.0 34 107.0 35 110.0 36 113.0 37 158.5 38 204.0 39 220.5 40 237.0 41 275.0 42 313.0 43 317.0 44 321.0 45 350.5 46 380.0 47 354.5 48 329.0 49 305.0 50 281.0 51 279.5 52 278.0 53 262.5 54 247.0 55 208.5 56 170.0 57 163.0 58 156.0 59 150.0 60 144.0 61 126.5 62 109.0 63 102.5 64 96.0 65 99.5 66 103.0 67 89.0 68 75.0 69 70.5 70 66.0 71 62.0 72 58.0 73 48.5 74 39.0 75 33.0 76 27.0 77 24.0 78 21.0 79 15.5 80 10.0 81 7.0 82 4.0 83 3.5 84 3.0 85 2.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 5.1499999999999995 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 96.2480458572173 92.35 2 3.41323606044815 6.550000000000001 3 0.26055237102657636 0.75 4 0.05211047420531526 0.2 5 0.0 0.0 6 0.02605523710265763 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTAT 6 0.15 TruSeq Adapter, Index 20 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645265 READS because READLEN < 1 Read 1645265 spots for SRR6322422.sra Written 1645265 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra Rejected 1645260 READS because READLEN < 1 Read 1645260 spots for SRR6322422.sra Written 1645260 spots for SRR6322422.sra SRR ids: ['SRR6322422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7yile20d SRR6322422.sra spots: 32905205 blocks: [[1, 1645260], [1645261, 3290520], [3290521, 4935780], [4935781, 6581040], [6581041, 8226300], [8226301, 9871560], [9871561, 11516820], [11516821, 13162080], [13162081, 14807340], [14807341, 16452600], [16452601, 18097860], [18097861, 19743120], [19743121, 21388380], [21388381, 23033640], [23033641, 24678900], [24678901, 26324160], [26324161, 27969420], [27969421, 29614680], [29614681, 31259940], [31259941, 32905205]] SRR6322422 file size 4605594 SRR6322422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322422 SRR6322422_1.fastq Input file: SRR6322422_1.fastq trimmed: SRR6322422-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:15:59 2024 >> started Sat Dec 7 12:16:11 2024 >> done (12.219s) 32905205 reads processed; of these: 53 ( 0.00%) short reads filtered out after trimming by size control 51096 ( 0.16%) empty reads filtered out after trimming by size control 32854056 (99.84%) reads available; of these: 23 ( 0.00%) trimmed reads available after processing 32854033 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 8 0.00% 50 32854033 100.00% 32854056 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=16 prefix-density=0.12 prefix-fanout=3.1 sequence=TCCTTGCCGTTCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=270.62 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.4 sequence=CCGCCGCCGCGCCGACCTCCTCCGCGATCTTGTGCCTGTGCGCGTTTTCCGGGTCCTTCTTTGCCTCGTGCTTCTCGTAGAGGGCGAAGGCGCCAGCGGCGGCGGC Started job on | Dec 07 12:16:26 Started mapping on | Dec 07 12:16:26 Finished on | Dec 07 12:16:53 Mapping speed, Million of reads per hour | 4380.54 Number of input reads | 32854056 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 31686376 Uniquely mapped reads % | 96.45% Average mapped length | 49.82 Number of splices: Total | 4720709 Number of splices: Annotated (sjdb) | 4562508 Number of splices: GT/AG | 4658525 Number of splices: GC/AG | 53219 Number of splices: AT/AC | 3525 Number of splices: Non-canonical | 5440 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 873823 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 98669 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293857 293857 293857 N_multimapping 873823 873823 873823 N_noFeature 1498763 31000256 1741650 N_ambiguous 478260 2545 35380 UnstrandedReadsAssigned:29709353 PositiveStrandReadsAssigned:683575 NegativeStrandReadsAssigned:29909346 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322422 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322422-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,854,056 reads, 29,399,962 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52973 SRR6322422.ke.tsv 35125 SRR6322422.se.tsv 88098 total ==> SRR6322422.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 32.9988 2.39577 PNS24247 1044 945 99.2831 6.38434 PNS24249 1928 1829 448.326 14.8954 PNS24246 1044 945 99.2831 6.38434 PNS24248 1044 945 99.2831 6.38434 PNS24244 1471 1372 32.8264 1.45392 PNS24243 293 194 0 0 KQK14069 1603 1504 14412.3 582.315 KQK14071 474 375 2977.52 482.499 ==> SRR6322422.se.tsv <== BRADI_1g14170v3 18954 BRADI_1g53295v3 445 BRADI_1g59795v3 658 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 504 BRADI_1g74790v3 301 BRADI_1g09890v3 0 BRADI_1g77505v3 503 BRADI_1g48960v3 1 SRR6322422 completed mapping pipeline successfully