Starting /dee2/code/volunteer_pipeline.sh SRR6322423 current disk space = 1543150727168 free memory = 1602678288 SRR6322423 SRAfilesize 754dbe0c80cf329752ce609ddc6cc87d SRR6322423.sra SRR6322423.sra file validated SRR6322423 is single end SRR6322423 is conventional basespace SRR6322423 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322423_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.025 32.0 32.0 32.0 27.0 32.0 2 31.36 32.0 32.0 32.0 32.0 32.0 3 34.9375 37.0 32.0 37.0 32.0 37.0 4 35.73 37.0 37.0 37.0 32.0 37.0 5 36.6875 37.0 37.0 37.0 37.0 37.0 6 40.078 41.0 41.0 41.0 37.0 41.0 7 39.75425 41.0 41.0 41.0 37.0 41.0 8 39.6705 41.0 41.0 41.0 37.0 41.0 9 40.05975 41.0 41.0 41.0 37.0 41.0 10 40.49875 41.0 41.0 41.0 41.0 41.0 11 40.25625 41.0 41.0 41.0 41.0 41.0 12 40.39525 41.0 41.0 41.0 41.0 41.0 13 40.37075 41.0 41.0 41.0 41.0 41.0 14 39.8005 41.0 41.0 41.0 37.0 41.0 15 39.687 41.0 41.0 41.0 37.0 41.0 16 39.2315 41.0 41.0 41.0 37.0 41.0 17 40.233 41.0 41.0 41.0 37.0 41.0 18 40.1375 41.0 41.0 41.0 37.0 41.0 19 39.77025 41.0 41.0 41.0 37.0 41.0 20 39.47375 41.0 41.0 41.0 37.0 41.0 21 40.266 41.0 41.0 41.0 41.0 41.0 22 39.787 41.0 41.0 41.0 37.0 41.0 23 39.6635 41.0 41.0 41.0 37.0 41.0 24 39.712 41.0 41.0 41.0 37.0 41.0 25 40.12175 41.0 41.0 41.0 37.0 41.0 26 39.85175 41.0 41.0 41.0 37.0 41.0 27 39.92975 41.0 41.0 41.0 37.0 41.0 28 38.79775 41.0 41.0 41.0 32.0 41.0 29 39.73725 41.0 41.0 41.0 37.0 41.0 30 39.8495 41.0 41.0 41.0 37.0 41.0 31 38.612 41.0 41.0 41.0 32.0 41.0 32 39.15875 41.0 41.0 41.0 37.0 41.0 33 38.4255 41.0 41.0 41.0 32.0 41.0 34 39.34825 41.0 41.0 41.0 37.0 41.0 35 38.848 41.0 41.0 41.0 37.0 41.0 36 39.5415 41.0 41.0 41.0 37.0 41.0 37 38.77225 41.0 41.0 41.0 32.0 41.0 38 38.78125 41.0 41.0 41.0 32.0 41.0 39 39.888 41.0 41.0 41.0 37.0 41.0 40 40.13625 41.0 41.0 41.0 37.0 41.0 41 36.2995 41.0 37.0 41.0 22.0 41.0 42 38.6365 41.0 41.0 41.0 32.0 41.0 43 39.79275 41.0 41.0 41.0 37.0 41.0 44 38.79675 41.0 41.0 41.0 32.0 41.0 45 33.798 41.0 27.0 41.0 12.0 41.0 46 38.936 41.0 37.0 41.0 37.0 41.0 47 37.7075 41.0 37.0 41.0 27.0 41.0 48 37.51 41.0 37.0 41.0 27.0 41.0 49 37.57825 41.0 37.0 41.0 27.0 41.0 50 38.43725 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 1.0 26 6.0 27 8.0 28 23.0 29 29.0 30 48.0 31 46.0 32 57.0 33 78.0 34 97.0 35 149.0 36 163.0 37 209.0 38 377.0 39 870.0 40 1837.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.53553553553554 8.483483483483484 4.77977977977978 51.201201201201194 2 20.29352226720648 9.817813765182185 43.09210526315789 26.796558704453442 3 21.15 11.799999999999999 24.675 42.375 4 27.500000000000004 18.475 21.7 32.324999999999996 5 28.275 25.324999999999996 25.15 21.25 6 23.45 28.95 23.9 23.7 7 18.325 25.1 37.7 18.875 8 18.325 22.575 34.8 24.3 9 18.7 19.5 36.3 25.5 10 22.425 31.724999999999998 26.55 19.3 11 24.325 25.2 24.85 25.624999999999996 12 23.400000000000002 21.975 26.924999999999997 27.700000000000003 13 24.4 24.525 25.45 25.624999999999996 14 22.3 25.0 28.1 24.6 15 21.625 24.025 27.35 27.0 16 24.525 23.150000000000002 25.15 27.175 17 22.475 24.075 28.4 25.05 18 22.85 24.775 25.974999999999998 26.400000000000002 19 24.95 24.85 24.375 25.825 20 24.4 24.099999999999998 26.724999999999998 24.775 21 24.3 23.1 26.275 26.325 22 24.85 25.25 24.825 25.074999999999996 23 24.025 24.925 26.224999999999998 24.825 24 23.7 24.55 24.925 26.825 25 23.65 25.0 24.15 27.200000000000003 26 22.3 26.6 26.674999999999997 24.425 27 23.974999999999998 23.575 25.45 27.0 28 23.25 25.35 24.6 26.8 29 22.775000000000002 26.275 27.125 23.825 30 23.775 23.549999999999997 26.674999999999997 26.0 31 24.0 22.650000000000002 25.724999999999998 27.625 32 24.0 24.45 25.674999999999997 25.874999999999996 33 23.575 24.275 25.95 26.200000000000003 34 24.275 24.275 24.65 26.8 35 22.775000000000002 23.3 28.249999999999996 25.674999999999997 36 23.849999999999998 22.675 24.8 28.675 37 24.15 24.975 25.424999999999997 25.45 38 22.975 25.025 26.474999999999998 25.525 39 23.0 23.775 24.7 28.525 40 23.974999999999998 24.5 25.674999999999997 25.85 41 24.15 24.375 26.200000000000003 25.275 42 23.549999999999997 24.625 25.474999999999998 26.35 43 24.275 24.175 26.200000000000003 25.35 44 23.075000000000003 24.0 26.275 26.650000000000002 45 24.275 22.3 27.1 26.325 46 24.275 26.650000000000002 22.5 26.575 47 24.275 25.5 24.675 25.55 48 24.775 24.275 24.625 26.325 49 24.875 25.3 23.275000000000002 26.55 50 23.95 24.85 27.275 23.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 3.5 24 6.0 25 9.0 26 12.0 27 18.0 28 24.0 29 27.5 30 31.0 31 39.0 32 47.0 33 64.0 34 81.0 35 105.0 36 129.0 37 165.5 38 202.0 39 215.0 40 228.0 41 245.0 42 262.0 43 293.0 44 324.0 45 333.5 46 343.0 47 346.5 48 350.0 49 330.5 50 311.0 51 287.5 52 264.0 53 243.5 54 223.0 55 206.0 56 189.0 57 185.5 58 182.0 59 158.0 60 134.0 61 131.5 62 129.0 63 105.5 64 82.0 65 89.5 66 97.0 67 90.5 68 84.0 69 73.5 70 63.0 71 65.5 72 68.0 73 58.5 74 49.0 75 40.5 76 32.0 77 28.0 78 24.0 79 20.5 80 17.0 81 10.0 82 3.0 83 3.5 84 4.0 85 2.0 86 0.0 87 0.5 88 1.0 89 1.5 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 1.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.02842377260981 93.875 2 2.842377260981912 5.5 3 0.10335917312661498 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025839793281653745 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 13 0.325 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394286 READS because READLEN < 1 Read 1394286 spots for SRR6322423.sra Written 1394286 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra Rejected 1394274 READS because READLEN < 1 Read 1394274 spots for SRR6322423.sra Written 1394274 spots for SRR6322423.sra SRR ids: ['SRR6322423.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ig5k8kwy SRR6322423.sra spots: 27885492 blocks: [[1, 1394274], [1394275, 2788548], [2788549, 4182822], [4182823, 5577096], [5577097, 6971370], [6971371, 8365644], [8365645, 9759918], [9759919, 11154192], [11154193, 12548466], [12548467, 13942740], [13942741, 15337014], [15337015, 16731288], [16731289, 18125562], [18125563, 19519836], [19519837, 20914110], [20914111, 22308384], [22308385, 23702658], [23702659, 25096932], [25096933, 26491206], [26491207, 27885492]] SRR6322423 file size 3899696 SRR6322423 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322423 SRR6322423_1.fastq Input file: SRR6322423_1.fastq trimmed: SRR6322423-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:16:23 2024 >> started Sat Dec 7 12:16:41 2024 >> done (18.091s) 27885492 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 107736 ( 0.39%) empty reads filtered out after trimming by size control 27777701 (99.61%) reads available; of these: 3390 ( 0.01%) trimmed reads available after processing 27774311 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3386 0.01% 50 27774311 99.99% 27777701 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=19.47 fanout-score-rank=6 prefix-density=0.20 prefix-fanout=8.4 sequence=CTTCTCCTCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=116.69 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.7 sequence=CGCCGCCGCCGCG Started job on | Dec 07 12:16:55 Started mapping on | Dec 07 12:16:56 Finished on | Dec 07 12:17:19 Mapping speed, Million of reads per hour | 4347.81 Number of input reads | 27777701 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26788507 Uniquely mapped reads % | 96.44% Average mapped length | 49.82 Number of splices: Total | 3971152 Number of splices: Annotated (sjdb) | 3828556 Number of splices: GT/AG | 3920144 Number of splices: GC/AG | 43687 Number of splices: AT/AC | 2827 Number of splices: Non-canonical | 4494 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 666555 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 117653 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322639 322639 322639 N_multimapping 666555 666555 666555 N_noFeature 1247456 26230984 1452698 N_ambiguous 376799 2038 25096 UnstrandedReadsAssigned:25164252 PositiveStrandReadsAssigned:555485 NegativeStrandReadsAssigned:25310713 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322423 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322423-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,777,701 reads, 25,021,484 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52973 SRR6322423.ke.tsv 35125 SRR6322423.se.tsv 88098 total ==> SRR6322423.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 74.2618 5.71221 PNS24249 1928 1829 218.519 8.68451 PNS24246 1044 945 74.2618 5.71221 PNS24248 1044 945 74.2618 5.71221 PNS24244 1471 1372 50.696 2.6859 PNS24243 293 194 0 0 KQK14069 1603 1504 798.781 38.6056 KQK14071 474 375 226.82 43.9664 ==> SRR6322423.se.tsv <== BRADI_1g14170v3 1126 BRADI_1g53295v3 226 BRADI_1g59795v3 724 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 629 BRADI_1g74790v3 346 BRADI_1g09890v3 1 BRADI_1g77505v3 375 BRADI_1g48960v3 4 SRR6322423 completed mapping pipeline successfully