Starting /dee2/code/volunteer_pipeline.sh SRR6322424 current disk space = 1543152197632 free memory = 1602655952 SRR6322424 SRAfilesize 5b33c71a2070e0414137e692831e421e SRR6322424.sra SRR6322424.sra file validated SRR6322424 is single end SRR6322424 is conventional basespace SRR6322424 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6075 32.0 32.0 32.0 32.0 32.0 2 30.185 32.0 32.0 32.0 32.0 32.0 3 35.4325 37.0 32.0 37.0 32.0 37.0 4 34.6225 37.0 37.0 37.0 27.0 37.0 5 35.7825 37.0 37.0 37.0 32.0 37.0 6 40.148 41.0 41.0 41.0 37.0 41.0 7 40.21625 41.0 41.0 41.0 37.0 41.0 8 40.4545 41.0 41.0 41.0 41.0 41.0 9 40.10525 41.0 41.0 41.0 37.0 41.0 10 40.32875 41.0 41.0 41.0 41.0 41.0 11 39.105 41.0 41.0 41.0 37.0 41.0 12 39.97225 41.0 41.0 41.0 37.0 41.0 13 40.3085 41.0 41.0 41.0 41.0 41.0 14 40.422 41.0 41.0 41.0 41.0 41.0 15 39.706 41.0 41.0 41.0 37.0 41.0 16 39.56675 41.0 41.0 41.0 37.0 41.0 17 40.327 41.0 41.0 41.0 41.0 41.0 18 40.286 41.0 41.0 41.0 41.0 41.0 19 40.275 41.0 41.0 41.0 41.0 41.0 20 39.87075 41.0 41.0 41.0 37.0 41.0 21 38.1175 41.0 37.0 41.0 32.0 41.0 22 39.8035 41.0 41.0 41.0 37.0 41.0 23 37.82275 41.0 37.0 41.0 27.0 41.0 24 39.4265 41.0 41.0 41.0 37.0 41.0 25 39.64375 41.0 41.0 41.0 37.0 41.0 26 38.26425 41.0 41.0 41.0 32.0 41.0 27 33.874 41.0 27.0 41.0 12.0 41.0 28 35.31325 41.0 32.0 41.0 22.0 41.0 29 38.86475 41.0 41.0 41.0 32.0 41.0 30 39.27375 41.0 41.0 41.0 37.0 41.0 31 38.99125 41.0 41.0 41.0 37.0 41.0 32 38.67325 41.0 41.0 41.0 32.0 41.0 33 32.95325 41.0 27.0 41.0 12.0 41.0 34 37.60975 41.0 37.0 41.0 27.0 41.0 35 39.049 41.0 41.0 41.0 37.0 41.0 36 39.8375 41.0 41.0 41.0 37.0 41.0 37 39.815 41.0 41.0 41.0 37.0 41.0 38 38.7425 41.0 41.0 41.0 32.0 41.0 39 38.585 41.0 41.0 41.0 32.0 41.0 40 38.95375 41.0 41.0 41.0 37.0 41.0 41 39.41025 41.0 41.0 41.0 37.0 41.0 42 39.518 41.0 41.0 41.0 37.0 41.0 43 39.597 41.0 41.0 41.0 37.0 41.0 44 38.9465 41.0 41.0 41.0 37.0 41.0 45 39.05575 41.0 41.0 41.0 37.0 41.0 46 33.0195 37.0 27.0 41.0 12.0 41.0 47 37.20225 41.0 37.0 41.0 27.0 41.0 48 37.91775 41.0 37.0 41.0 27.0 41.0 49 39.57675 41.0 41.0 41.0 37.0 41.0 50 39.72 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 1.0 25 4.0 26 8.0 27 13.0 28 18.0 29 43.0 30 44.0 31 46.0 32 85.0 33 86.0 34 102.0 35 171.0 36 203.0 37 333.0 38 513.0 39 961.0 40 1366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.18454613653413 9.00225056264066 4.951237809452363 47.86196549137284 2 20.767023219410383 9.992173232454995 45.160448734672585 24.08035481346204 3 20.599999999999998 13.850000000000001 24.975 40.575 4 25.874999999999996 20.7 22.05 31.374999999999996 5 28.849999999999998 23.925 25.6 21.625 6 24.575 28.475 23.674999999999997 23.275000000000002 7 19.775000000000002 24.625 38.85 16.75 8 18.425 23.525 33.225 24.825 9 19.6 18.7 36.425000000000004 25.275 10 20.925 33.1 26.400000000000002 19.575 11 25.25 25.35 24.349999999999998 25.05 12 23.724999999999998 21.725 27.6 26.950000000000003 13 24.45 24.975 26.974999999999998 23.599999999999998 14 21.525 25.575 26.650000000000002 26.25 15 24.2 23.674999999999997 25.575 26.55 16 24.6 23.7 25.324999999999996 26.375 17 24.925 24.099999999999998 25.224999999999998 25.75 18 23.525 25.0 26.125 25.35 19 24.6 23.45 25.674999999999997 26.275 20 22.900000000000002 24.6 27.400000000000002 25.1 21 24.075 23.925 24.45 27.55 22 25.650000000000002 24.3 23.45 26.6 23 23.825 26.275 25.074999999999996 24.825 24 24.0 21.875 25.924999999999997 28.199999999999996 25 25.724999999999998 23.625 25.124999999999996 25.525 26 23.549999999999997 24.15 25.900000000000002 26.400000000000002 27 24.725 23.599999999999998 24.349999999999998 27.325 28 24.474999999999998 25.1 24.25 26.174999999999997 29 22.825 23.425 27.250000000000004 26.5 30 23.325000000000003 23.724999999999998 25.45 27.500000000000004 31 24.275 23.9 25.424999999999997 26.400000000000002 32 24.925 23.825 25.75 25.5 33 24.7 22.425 25.074999999999996 27.800000000000004 34 24.2 24.349999999999998 24.85 26.6 35 23.05 25.1 25.124999999999996 26.724999999999998 36 24.175 24.4 24.65 26.775 37 24.575 23.875 25.25 26.3 38 23.65 25.900000000000002 24.6 25.85 39 24.925 24.6 23.5 26.974999999999998 40 24.6 25.224999999999998 23.175 27.0 41 24.5 25.724999999999998 24.45 25.324999999999996 42 23.575 24.925 24.775 26.724999999999998 43 24.5 24.775 25.025 25.7 44 23.525 25.85 23.799999999999997 26.825 45 24.6 22.525000000000002 25.374999999999996 27.500000000000004 46 25.974999999999998 24.45 22.475 27.1 47 24.875 24.9 25.424999999999997 24.8 48 23.625 23.799999999999997 25.124999999999996 27.450000000000003 49 23.95 25.75 24.95 25.35 50 23.925 24.925 25.85 25.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.5 24 5.0 25 8.5 26 12.0 27 14.5 28 17.0 29 20.5 30 24.0 31 39.5 32 55.0 33 67.5 34 80.0 35 99.0 36 118.0 37 158.5 38 199.0 39 216.0 40 233.0 41 260.0 42 287.0 43 291.0 44 295.0 45 314.0 46 333.0 47 318.0 48 303.0 49 314.0 50 325.0 51 287.5 52 250.0 53 231.5 54 213.0 55 206.5 56 200.0 57 197.0 58 194.0 59 163.5 60 133.0 61 127.0 62 121.0 63 124.0 64 127.0 65 117.0 66 107.0 67 95.5 68 84.0 69 83.0 70 82.0 71 74.0 72 66.0 73 52.5 74 39.0 75 36.5 76 34.0 77 32.0 78 30.0 79 23.0 80 16.0 81 11.0 82 6.0 83 4.5 84 3.0 85 2.5 86 2.0 87 1.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 4.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.325 #Duplication Level Percentage of deduplicated Percentage of total 1 96.98935894108487 93.425 2 2.699195432130807 5.2 3 0.23358422008824295 0.675 4 0.05190760446405398 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02595380223202699 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTAT 20 0.5 TruSeq Adapter, Index 21 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1379668 READS because READLEN < 1 Read 1379668 spots for SRR6322424.sra Written 1379668 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra Rejected 1379661 READS because READLEN < 1 Read 1379661 spots for SRR6322424.sra Written 1379661 spots for SRR6322424.sra SRR ids: ['SRR6322424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd___8qbky3 SRR6322424.sra spots: 27593227 blocks: [[1, 1379661], [1379662, 2759322], [2759323, 4138983], [4138984, 5518644], [5518645, 6898305], [6898306, 8277966], [8277967, 9657627], [9657628, 11037288], [11037289, 12416949], [12416950, 13796610], [13796611, 15176271], [15176272, 16555932], [16555933, 17935593], [17935594, 19315254], [19315255, 20694915], [20694916, 22074576], [22074577, 23454237], [23454238, 24833898], [24833899, 26213559], [26213560, 27593227]] SRR6322424 file size 3858597 SRR6322424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322424 SRR6322424_1.fastq Input file: SRR6322424_1.fastq trimmed: SRR6322424-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:16:37 2024 >> started Sat Dec 7 12:16:56 2024 >> done (19.798s) 27593227 reads processed; of these: 59 ( 0.00%) short reads filtered out after trimming by size control 186063 ( 0.67%) empty reads filtered out after trimming by size control 27407105 (99.33%) reads available; of these: 16 ( 0.00%) trimmed reads available after processing 27407089 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 9 0.00% 50 27407089 100.00% 27407105 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=16 prefix-density=0.15 prefix-fanout=2.9 sequence=GCTGCTGCAGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=15 fanout-score=169.95 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.2 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGA Started job on | Dec 07 12:17:06 Started mapping on | Dec 07 12:17:07 Finished on | Dec 07 12:17:35 Mapping speed, Million of reads per hour | 3523.77 Number of input reads | 27407105 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26367947 Uniquely mapped reads % | 96.21% Average mapped length | 49.83 Number of splices: Total | 3892102 Number of splices: Annotated (sjdb) | 3754716 Number of splices: GT/AG | 3834298 Number of splices: GC/AG | 50460 Number of splices: AT/AC | 2284 Number of splices: Non-canonical | 5060 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 700027 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 132963 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 339131 339131 339131 N_multimapping 700027 700027 700027 N_noFeature 1217586 25813034 1411063 N_ambiguous 400327 1600 40531 UnstrandedReadsAssigned:24750034 PositiveStrandReadsAssigned:553313 NegativeStrandReadsAssigned:24916353 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322424 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322424-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,407,105 reads, 24,493,299 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR6322424.ke.tsv 35125 SRR6322424.se.tsv 88098 total ==> SRR6322424.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 67.0077 5.44929 PNS24247 1044 945 84.4544 6.08319 PNS24249 1928 1829 287.78 10.71 PNS24246 1044 945 84.4544 6.08319 PNS24248 1044 945 84.4544 6.08319 PNS24244 1471 1372 17.8492 0.885535 PNS24243 293 194 0 0 KQK14069 1603 1504 48678 2203.06 KQK14071 474 375 9996.67 1814.53 ==> SRR6322424.se.tsv <== BRADI_1g14170v3 61597 BRADI_1g53295v3 270 BRADI_1g59795v3 555 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 898 BRADI_1g74790v3 965 BRADI_1g09890v3 13 BRADI_1g77505v3 530 BRADI_1g48960v3 0 SRR6322424 completed mapping pipeline successfully