Starting /dee2/code/volunteer_pipeline.sh SRR6322425 current disk space = 1543152197632 free memory = 1602659836 SRR6322425 SRAfilesize 536f721ad5f0d2d46b5ade8ced3aaacc SRR6322425.sra SRR6322425.sra file validated SRR6322425 is single end SRR6322425 is conventional basespace SRR6322425 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.43875 32.0 32.0 32.0 32.0 32.0 2 30.14125 32.0 32.0 32.0 32.0 32.0 3 35.28625 37.0 32.0 37.0 32.0 37.0 4 34.22 37.0 32.0 37.0 27.0 37.0 5 35.635 37.0 37.0 37.0 32.0 37.0 6 39.9885 41.0 41.0 41.0 37.0 41.0 7 40.22075 41.0 41.0 41.0 37.0 41.0 8 40.36075 41.0 41.0 41.0 41.0 41.0 9 39.959 41.0 41.0 41.0 37.0 41.0 10 40.2565 41.0 41.0 41.0 37.0 41.0 11 38.605 41.0 41.0 41.0 32.0 41.0 12 39.759 41.0 41.0 41.0 37.0 41.0 13 40.073 41.0 41.0 41.0 37.0 41.0 14 40.306 41.0 41.0 41.0 41.0 41.0 15 39.395 41.0 41.0 41.0 37.0 41.0 16 39.3335 41.0 41.0 41.0 37.0 41.0 17 40.1455 41.0 41.0 41.0 37.0 41.0 18 40.22825 41.0 41.0 41.0 37.0 41.0 19 40.1185 41.0 41.0 41.0 37.0 41.0 20 39.6655 41.0 41.0 41.0 37.0 41.0 21 37.4225 41.0 37.0 41.0 27.0 41.0 22 39.50325 41.0 41.0 41.0 37.0 41.0 23 37.3945 41.0 37.0 41.0 27.0 41.0 24 39.46325 41.0 41.0 41.0 37.0 41.0 25 39.4495 41.0 41.0 41.0 37.0 41.0 26 38.0415 41.0 37.0 41.0 32.0 41.0 27 33.2565 41.0 27.0 41.0 12.0 41.0 28 34.97275 41.0 32.0 41.0 22.0 41.0 29 38.59075 41.0 37.0 41.0 32.0 41.0 30 39.0335 41.0 41.0 41.0 37.0 41.0 31 38.77075 41.0 41.0 41.0 32.0 41.0 32 38.3725 41.0 41.0 41.0 32.0 41.0 33 32.13275 37.0 27.0 41.0 12.0 41.0 34 37.33575 41.0 37.0 41.0 27.0 41.0 35 38.69025 41.0 41.0 41.0 32.0 41.0 36 39.62375 41.0 41.0 41.0 37.0 41.0 37 39.4465 41.0 41.0 41.0 37.0 41.0 38 38.03075 41.0 41.0 41.0 32.0 41.0 39 38.096 41.0 37.0 41.0 32.0 41.0 40 38.38825 41.0 41.0 41.0 32.0 41.0 41 38.943 41.0 41.0 41.0 37.0 41.0 42 39.14125 41.0 41.0 41.0 37.0 41.0 43 39.3765 41.0 41.0 41.0 37.0 41.0 44 38.564 41.0 41.0 41.0 32.0 41.0 45 38.572 41.0 41.0 41.0 32.0 41.0 46 32.069 37.0 22.0 41.0 12.0 41.0 47 36.293 41.0 37.0 41.0 22.0 41.0 48 37.198 41.0 37.0 41.0 27.0 41.0 49 39.23075 41.0 41.0 41.0 37.0 41.0 50 39.53475 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 3.0 25 6.0 26 12.0 27 15.0 28 32.0 29 34.0 30 49.0 31 64.0 32 91.0 33 127.0 34 148.0 35 161.0 36 226.0 37 368.0 38 596.0 39 942.0 40 1124.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.07003501750875 10.48024012006003 9.154577288644322 40.29514757378689 2 24.895506792058516 12.669801462904912 32.654127481713694 29.780564263322884 3 20.599999999999998 14.625 25.224999999999998 39.550000000000004 4 26.375 21.75 21.025 30.85 5 26.900000000000002 25.474999999999998 24.725 22.900000000000002 6 23.325000000000003 28.599999999999998 26.025 22.05 7 18.675 24.85 38.175 18.3 8 19.2 23.974999999999998 31.4 25.424999999999997 9 20.375 22.525000000000002 32.15 24.95 10 21.125 33.650000000000006 25.2 20.025000000000002 11 26.724999999999998 24.3 21.7 27.275 12 22.925 23.525 25.8 27.750000000000004 13 22.05 25.35 27.125 25.474999999999998 14 22.35 25.825 25.575 26.25 15 23.225 24.675 26.450000000000003 25.650000000000002 16 23.35 24.85 25.1 26.700000000000003 17 24.6 25.174999999999997 24.325 25.900000000000002 18 23.200000000000003 26.1 25.374999999999996 25.324999999999996 19 21.8 25.775 24.975 27.450000000000003 20 23.849999999999998 25.874999999999996 24.6 25.674999999999997 21 24.275 25.074999999999996 25.650000000000002 25.0 22 23.974999999999998 26.450000000000003 24.625 24.95 23 23.3 25.3 26.075 25.324999999999996 24 23.375 23.775 25.7 27.150000000000002 25 23.05 25.25 25.525 26.174999999999997 26 22.675 27.3 24.349999999999998 25.674999999999997 27 25.474999999999998 25.85 22.825 25.85 28 22.400000000000002 26.55 25.324999999999996 25.724999999999998 29 24.2 24.125 25.45 26.224999999999998 30 22.1 24.55 26.450000000000003 26.900000000000002 31 23.3 25.2 25.35 26.150000000000002 32 22.975 24.675 25.15 27.200000000000003 33 23.674999999999997 24.099999999999998 26.275 25.95 34 23.549999999999997 25.15 25.7 25.6 35 24.0 25.5 24.975 25.525 36 22.1 26.674999999999997 24.775 26.450000000000003 37 24.775 24.525 25.174999999999997 25.525 38 24.25 25.85 24.224999999999998 25.674999999999997 39 22.925 25.75 26.1 25.224999999999998 40 23.799999999999997 26.0 25.025 25.174999999999997 41 23.525 24.95 25.45 26.075 42 24.224999999999998 24.224999999999998 25.55 26.0 43 23.525 24.325 25.474999999999998 26.674999999999997 44 22.925 24.2 25.624999999999996 27.250000000000004 45 24.05 25.924999999999997 26.25 23.775 46 26.35 23.925 24.4 25.324999999999996 47 22.75 26.224999999999998 26.25 24.775 48 22.25 25.124999999999996 26.025 26.6 49 25.7 24.099999999999998 24.075 26.125 50 22.875 24.75 25.775 26.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.5 20 5.0 21 4.0 22 3.0 23 3.0 24 3.0 25 8.5 26 14.0 27 13.0 28 12.0 29 24.0 30 36.0 31 45.0 32 54.0 33 69.0 34 84.0 35 111.0 36 138.0 37 166.0 38 194.0 39 217.0 40 240.0 41 263.5 42 287.0 43 299.5 44 312.0 45 332.0 46 352.0 47 341.5 48 331.0 49 326.5 50 322.0 51 303.0 52 284.0 53 252.0 54 220.0 55 214.0 56 208.0 57 177.0 58 146.0 59 132.5 60 119.0 61 113.0 62 107.0 63 103.5 64 100.0 65 95.5 66 91.0 67 91.5 68 92.0 69 90.0 70 88.0 71 68.5 72 49.0 73 38.5 74 28.0 75 32.0 76 36.0 77 25.0 78 14.0 79 14.0 80 14.0 81 13.0 82 12.0 83 7.0 84 2.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 4.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.88716055892434 90.925 2 3.6119166886369634 6.8500000000000005 3 0.3691009754811495 1.05 4 0.07909306617453203 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05272871078302136 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 24 0.6 TruSeq Adapter, Index 3 (100% over 50bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC 11 0.27499999999999997 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470112 READS because READLEN < 1 Read 1470112 spots for SRR6322425.sra Written 1470112 spots for SRR6322425.sra Rejected 1470113 READS because READLEN < 1 Read 1470113 spots for SRR6322425.sra Written 1470113 spots for SRR6322425.sra SRR ids: ['SRR6322425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ucmzzn0 SRR6322425.sra spots: 29402241 blocks: [[1, 1470112], [1470113, 2940224], [2940225, 4410336], [4410337, 5880448], [5880449, 7350560], [7350561, 8820672], [8820673, 10290784], [10290785, 11760896], [11760897, 13231008], [13231009, 14701120], [14701121, 16171232], [16171233, 17641344], [17641345, 19111456], [19111457, 20581568], [20581569, 22051680], [22051681, 23521792], [23521793, 24991904], [24991905, 26462016], [26462017, 27932128], [27932129, 29402241]] SRR6322425 file size 4112989 SRR6322425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322425 SRR6322425_1.fastq Input file: SRR6322425_1.fastq trimmed: SRR6322425-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:16:35 2024 >> started Sat Dec 7 12:16:54 2024 >> done (19.461s) 29402241 reads processed; of these: 79 ( 0.00%) short reads filtered out after trimming by size control 268243 ( 0.91%) empty reads filtered out after trimming by size control 29133919 (99.09%) reads available; of these: 16 ( 0.00%) trimmed reads available after processing 29133903 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 10 0.00% 50 29133903 100.00% 29133919 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.07 prefix-fanout=1.9 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=6 fanout-score=141.72 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=19.0 sequence=CTTCTTCTTCCTC Started job on | Dec 07 12:17:04 Started mapping on | Dec 07 12:17:04 Finished on | Dec 07 12:17:34 Mapping speed, Million of reads per hour | 3496.07 Number of input reads | 29133919 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 27840404 Uniquely mapped reads % | 95.56% Average mapped length | 49.81 Number of splices: Total | 4074819 Number of splices: Annotated (sjdb) | 3951322 Number of splices: GT/AG | 4022061 Number of splices: GC/AG | 45289 Number of splices: AT/AC | 2898 Number of splices: Non-canonical | 4571 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 796871 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 78218 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 496644 496644 496644 N_multimapping 796871 796871 796871 N_noFeature 1248617 27258358 1452677 N_ambiguous 405585 2130 28042 UnstrandedReadsAssigned:26186202 PositiveStrandReadsAssigned:579916 NegativeStrandReadsAssigned:26359685 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322425 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322425-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,133,919 reads, 25,940,644 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6322425.ke.tsv 35125 SRR6322425.se.tsv 88098 total ==> SRR6322425.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 9.44619 0.795873 PNS24247 1044 945 133.314 9.94845 PNS24249 1928 1829 262.182 10.1088 PNS24246 1044 945 133.314 9.94845 PNS24248 1044 945 133.314 9.94845 PNS24244 1471 1372 15.431 0.793146 PNS24243 293 194 1 0.363505 KQK14069 1603 1504 8944.49 419.392 KQK14071 474 375 782.774 147.203 ==> SRR6322425.se.tsv <== BRADI_1g14170v3 10538 BRADI_1g53295v3 450 BRADI_1g59795v3 668 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 439 BRADI_1g74790v3 273 BRADI_1g09890v3 0 BRADI_1g77505v3 389 BRADI_1g48960v3 0 SRR6322425 completed mapping pipeline successfully