Starting /dee2/code/volunteer_pipeline.sh SRR6322426 current disk space = 1543368237056 free memory = 1602176260 SRR6322426 SRAfilesize 95d415c7cc3077178c3b110902dfa452 SRR6322426.sra SRR6322426.sra file validated SRR6322426 is single end SRR6322426 is conventional basespace SRR6322426 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5225 32.0 32.0 32.0 32.0 32.0 2 30.14 32.0 32.0 32.0 32.0 32.0 3 35.34 37.0 32.0 37.0 32.0 37.0 4 34.5825 37.0 37.0 37.0 27.0 37.0 5 35.72375 37.0 37.0 37.0 32.0 37.0 6 40.11275 41.0 41.0 41.0 37.0 41.0 7 40.35 41.0 41.0 41.0 37.0 41.0 8 40.395 41.0 41.0 41.0 41.0 41.0 9 40.00475 41.0 41.0 41.0 37.0 41.0 10 40.28325 41.0 41.0 41.0 41.0 41.0 11 38.86375 41.0 41.0 41.0 32.0 41.0 12 39.938 41.0 41.0 41.0 37.0 41.0 13 40.22175 41.0 41.0 41.0 37.0 41.0 14 40.46625 41.0 41.0 41.0 41.0 41.0 15 39.5155 41.0 41.0 41.0 37.0 41.0 16 39.4985 41.0 41.0 41.0 37.0 41.0 17 40.1315 41.0 41.0 41.0 37.0 41.0 18 40.25375 41.0 41.0 41.0 41.0 41.0 19 40.15625 41.0 41.0 41.0 37.0 41.0 20 39.8055 41.0 41.0 41.0 37.0 41.0 21 37.8025 41.0 37.0 41.0 27.0 41.0 22 39.74725 41.0 41.0 41.0 37.0 41.0 23 37.59925 41.0 37.0 41.0 27.0 41.0 24 39.477 41.0 41.0 41.0 37.0 41.0 25 39.62175 41.0 41.0 41.0 37.0 41.0 26 38.26175 41.0 41.0 41.0 32.0 41.0 27 33.53025 41.0 27.0 41.0 12.0 41.0 28 35.2155 41.0 32.0 41.0 22.0 41.0 29 38.7885 41.0 37.0 41.0 32.0 41.0 30 39.17375 41.0 41.0 41.0 37.0 41.0 31 38.7555 41.0 41.0 41.0 32.0 41.0 32 38.473 41.0 41.0 41.0 32.0 41.0 33 32.329 37.0 27.0 41.0 12.0 41.0 34 37.31075 41.0 37.0 41.0 27.0 41.0 35 38.70025 41.0 41.0 41.0 32.0 41.0 36 39.60625 41.0 41.0 41.0 37.0 41.0 37 39.613 41.0 41.0 41.0 37.0 41.0 38 38.29 41.0 41.0 41.0 32.0 41.0 39 38.33075 41.0 41.0 41.0 32.0 41.0 40 38.77375 41.0 41.0 41.0 32.0 41.0 41 39.27725 41.0 41.0 41.0 37.0 41.0 42 39.351 41.0 41.0 41.0 37.0 41.0 43 39.66775 41.0 41.0 41.0 37.0 41.0 44 38.82025 41.0 41.0 41.0 32.0 41.0 45 38.947 41.0 41.0 41.0 37.0 41.0 46 32.59125 37.0 27.0 41.0 12.0 41.0 47 37.047 41.0 37.0 41.0 27.0 41.0 48 37.664 41.0 37.0 41.0 27.0 41.0 49 39.35925 41.0 41.0 41.0 37.0 41.0 50 39.712 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 11.0 27 7.0 28 23.0 29 36.0 30 41.0 31 67.0 32 97.0 33 98.0 34 133.0 35 162.0 36 228.0 37 331.0 38 558.0 39 988.0 40 1216.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.256692519389546 12.15911933950463 5.629221916437328 39.9549662246685 2 24.293933054393303 11.140167364016737 39.0428870292887 25.523012552301257 3 20.925 15.775 25.374999999999996 37.925 4 28.000000000000004 22.375 20.974999999999998 28.65 5 26.025 27.35 24.0 22.625 6 23.25 30.599999999999998 23.375 22.775000000000002 7 17.875 24.325 39.550000000000004 18.25 8 19.2 22.85 31.75 26.200000000000003 9 18.95 20.45 35.099999999999994 25.5 10 22.025 31.75 25.474999999999998 20.75 11 25.825 23.549999999999997 23.65 26.974999999999998 12 24.925 21.25 26.174999999999997 27.650000000000002 13 24.375 24.85 25.974999999999998 24.8 14 23.3 23.875 27.525 25.3 15 23.525 25.85 24.825 25.8 16 23.974999999999998 25.324999999999996 24.325 26.375 17 23.175 25.3 25.900000000000002 25.624999999999996 18 23.275000000000002 23.175 25.324999999999996 28.225 19 23.799999999999997 25.525 24.375 26.3 20 24.325 25.650000000000002 24.625 25.4 21 22.975 24.7 25.224999999999998 27.1 22 24.375 25.224999999999998 24.3 26.1 23 22.775000000000002 25.25 26.525 25.45 24 22.475 24.099999999999998 26.5 26.924999999999997 25 24.25 26.125 23.9 25.724999999999998 26 23.875 25.324999999999996 27.05 23.75 27 26.0 23.875 24.0 26.125 28 24.125 24.4 25.4 26.075 29 23.075000000000003 25.374999999999996 26.025 25.525 30 25.2 24.3 24.375 26.125 31 23.65 26.674999999999997 24.05 25.624999999999996 32 24.925 25.074999999999996 25.474999999999998 24.525 33 26.224999999999998 22.775000000000002 25.55 25.45 34 23.724999999999998 25.1 24.375 26.8 35 22.075 25.4 26.6 25.924999999999997 36 23.425 25.374999999999996 23.925 27.275 37 25.95 24.575 24.8 24.675 38 23.025000000000002 25.15 25.424999999999997 26.400000000000002 39 23.575 23.974999999999998 25.900000000000002 26.55 40 25.624999999999996 25.224999999999998 23.7 25.45 41 24.675 25.724999999999998 24.925 24.675 42 23.425 24.95 25.7 25.924999999999997 43 24.7 24.45 24.25 26.6 44 23.674999999999997 23.849999999999998 25.55 26.924999999999997 45 23.799999999999997 23.9 25.575 26.724999999999998 46 26.85 24.099999999999998 25.2 23.849999999999998 47 24.125 25.124999999999996 24.95 25.8 48 22.8 25.45 25.45 26.3 49 25.1 25.05 23.025000000000002 26.825 50 23.1 25.074999999999996 25.3 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 2.0 24 3.0 25 7.0 26 11.0 27 18.5 28 26.0 29 30.5 30 35.0 31 50.0 32 65.0 33 82.5 34 100.0 35 114.0 36 128.0 37 160.5 38 193.0 39 205.0 40 217.0 41 261.0 42 305.0 43 323.5 44 342.0 45 312.5 46 283.0 47 298.5 48 314.0 49 310.5 50 307.0 51 279.0 52 251.0 53 236.5 54 222.0 55 205.5 56 189.0 57 185.5 58 182.0 59 157.5 60 133.0 61 129.0 62 125.0 63 112.0 64 99.0 65 102.5 66 106.0 67 91.0 68 76.0 69 76.0 70 76.0 71 68.5 72 61.0 73 54.0 74 47.0 75 46.0 76 45.0 77 34.5 78 24.0 79 17.5 80 11.0 81 11.0 82 11.0 83 9.0 84 7.0 85 3.5 86 0.0 87 1.0 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 4.3999999999999995 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.8508002065049 93.8 2 3.0717604543107897 5.949999999999999 3 0.05162622612287042 0.15 4 0.02581311306143521 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378427 READS because READLEN < 1 Read 1378427 spots for SRR6322426.sra Written 1378427 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra Rejected 1378412 READS because READLEN < 1 Read 1378412 spots for SRR6322426.sra Written 1378412 spots for SRR6322426.sra SRR ids: ['SRR6322426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bm_99ulx SRR6322426.sra spots: 27568255 blocks: [[1, 1378412], [1378413, 2756824], [2756825, 4135236], [4135237, 5513648], [5513649, 6892060], [6892061, 8270472], [8270473, 9648884], [9648885, 11027296], [11027297, 12405708], [12405709, 13784120], [13784121, 15162532], [15162533, 16540944], [16540945, 17919356], [17919357, 19297768], [19297769, 20676180], [20676181, 22054592], [22054593, 23433004], [23433005, 24811416], [24811417, 26189828], [26189829, 27568255]] SRR6322426 file size 3855085 SRR6322426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322426 SRR6322426_1.fastq Input file: SRR6322426_1.fastq trimmed: SRR6322426-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:44:03 2024 >> started Sat Dec 7 10:44:26 2024 >> done (23.322s) 27568255 reads processed; of these: 51 ( 0.00%) short reads filtered out after trimming by size control 41420 ( 0.15%) empty reads filtered out after trimming by size control 27526784 (99.85%) reads available; of these: 18 ( 0.00%) trimmed reads available after processing 27526766 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 11 0.00% 50 27526766 100.00% 27526784 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=17.67 fanout-score-rank=8 prefix-density=0.19 prefix-fanout=7.7 sequence=CTTCTCCTCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=136.05 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=13.4 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCAT Started job on | Dec 07 10:44:37 Started mapping on | Dec 07 10:44:38 Finished on | Dec 07 10:45:04 Mapping speed, Million of reads per hour | 3811.40 Number of input reads | 27526784 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26542105 Uniquely mapped reads % | 96.42% Average mapped length | 49.81 Number of splices: Total | 3755905 Number of splices: Annotated (sjdb) | 3624457 Number of splices: GT/AG | 3706998 Number of splices: GC/AG | 42013 Number of splices: AT/AC | 2670 Number of splices: Non-canonical | 4224 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 705227 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 100270 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 279452 279452 279452 N_multimapping 705227 705227 705227 N_noFeature 1161293 25927707 1394291 N_ambiguous 406565 1909 25455 UnstrandedReadsAssigned:24974247 PositiveStrandReadsAssigned:612489 NegativeStrandReadsAssigned:25122359 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322426 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322426-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,526,784 reads, 24,658,842 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52973 SRR6322426.ke.tsv 35125 SRR6322426.se.tsv 88098 total ==> SRR6322426.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.29074 0.109725 PNS24247 1044 945 86.8277 6.53762 PNS24249 1928 1829 317.436 12.3491 PNS24246 1044 945 86.8277 6.53762 PNS24248 1044 945 86.8277 6.53762 PNS24244 1471 1372 80.7899 4.18983 PNS24243 293 194 0 0 KQK14069 1603 1504 3839.54 181.645 KQK14071 474 375 668.651 126.871 ==> SRR6322426.se.tsv <== BRADI_1g14170v3 4902 BRADI_1g53295v3 231 BRADI_1g59795v3 750 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 505 BRADI_1g74790v3 461 BRADI_1g09890v3 0 BRADI_1g77505v3 491 BRADI_1g48960v3 1 SRR6322426 completed mapping pipeline successfully