Starting /dee2/code/volunteer_pipeline.sh SRR6322427 current disk space = 1543336108032 free memory = 1598123416 SRR6322427 SRAfilesize dbff02ee57ba82cdab4f92ea7952cea4 SRR6322427.sra SRR6322427.sra file validated SRR6322427 is single end SRR6322427 is conventional basespace SRR6322427 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5525 32.0 32.0 32.0 32.0 32.0 2 30.37 32.0 32.0 32.0 32.0 32.0 3 35.46375 37.0 32.0 37.0 32.0 37.0 4 34.81125 37.0 37.0 37.0 32.0 37.0 5 35.92625 37.0 37.0 37.0 32.0 37.0 6 40.13225 41.0 41.0 41.0 37.0 41.0 7 40.251 41.0 41.0 41.0 37.0 41.0 8 40.395 41.0 41.0 41.0 41.0 41.0 9 40.1045 41.0 41.0 41.0 37.0 41.0 10 40.29475 41.0 41.0 41.0 41.0 41.0 11 38.9685 41.0 41.0 41.0 37.0 41.0 12 39.99225 41.0 41.0 41.0 37.0 41.0 13 40.20775 41.0 41.0 41.0 41.0 41.0 14 40.36475 41.0 41.0 41.0 41.0 41.0 15 39.6315 41.0 41.0 41.0 37.0 41.0 16 39.5595 41.0 41.0 41.0 37.0 41.0 17 40.2405 41.0 41.0 41.0 41.0 41.0 18 40.2885 41.0 41.0 41.0 41.0 41.0 19 40.349 41.0 41.0 41.0 41.0 41.0 20 39.8575 41.0 41.0 41.0 37.0 41.0 21 38.0505 41.0 37.0 41.0 27.0 41.0 22 39.786 41.0 41.0 41.0 37.0 41.0 23 37.84375 41.0 37.0 41.0 27.0 41.0 24 39.5145 41.0 41.0 41.0 37.0 41.0 25 39.73175 41.0 41.0 41.0 37.0 41.0 26 38.4455 41.0 41.0 41.0 32.0 41.0 27 33.87075 41.0 27.0 41.0 12.0 41.0 28 35.5245 41.0 32.0 41.0 22.0 41.0 29 38.99975 41.0 37.0 41.0 37.0 41.0 30 39.417 41.0 41.0 41.0 37.0 41.0 31 39.16725 41.0 41.0 41.0 37.0 41.0 32 38.6605 41.0 41.0 41.0 32.0 41.0 33 33.0015 41.0 27.0 41.0 12.0 41.0 34 37.625 41.0 37.0 41.0 27.0 41.0 35 38.889 41.0 41.0 41.0 37.0 41.0 36 39.80975 41.0 41.0 41.0 37.0 41.0 37 39.70475 41.0 41.0 41.0 37.0 41.0 38 38.59575 41.0 41.0 41.0 32.0 41.0 39 38.2985 41.0 41.0 41.0 32.0 41.0 40 38.7395 41.0 41.0 41.0 32.0 41.0 41 39.4465 41.0 41.0 41.0 37.0 41.0 42 39.60575 41.0 41.0 41.0 37.0 41.0 43 39.6165 41.0 41.0 41.0 37.0 41.0 44 38.9185 41.0 41.0 41.0 37.0 41.0 45 38.94675 41.0 41.0 41.0 37.0 41.0 46 32.827 37.0 27.0 41.0 12.0 41.0 47 37.177 41.0 37.0 41.0 27.0 41.0 48 37.80825 41.0 37.0 41.0 27.0 41.0 49 39.4705 41.0 41.0 41.0 37.0 41.0 50 39.76325 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 4.0 26 10.0 27 14.0 28 24.0 29 31.0 30 34.0 31 42.0 32 81.0 33 99.0 34 135.0 35 165.0 36 219.0 37 296.0 38 510.0 39 980.0 40 1353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.254254254254253 9.334334334334335 4.92992992992993 56.481481481481474 2 17.735653077122826 10.153206959231369 48.79252142300701 23.318618540638795 3 18.224999999999998 14.674999999999999 25.775 41.325 4 25.95 21.3 21.05 31.7 5 26.474999999999998 28.1 25.624999999999996 19.8 6 21.125 30.425 25.55 22.900000000000002 7 17.2 25.45 39.15 18.2 8 18.4 22.275 33.95 25.374999999999996 9 17.875 18.825 38.1 25.2 10 21.075 31.0 26.75 21.175 11 25.6 24.675 23.474999999999998 26.25 12 22.075 21.375 26.8 29.75 13 23.9 23.799999999999997 25.724999999999998 26.575 14 22.7 24.8 26.974999999999998 25.525 15 23.1 23.575 26.200000000000003 27.125 16 23.05 25.624999999999996 25.1 26.224999999999998 17 23.200000000000003 24.825 25.924999999999997 26.05 18 21.95 23.875 27.400000000000002 26.775 19 24.0 24.65 23.825 27.525 20 22.650000000000002 25.75 26.700000000000003 24.9 21 23.75 23.275000000000002 27.250000000000004 25.724999999999998 22 23.45 24.75 24.075 27.725 23 24.075 25.0 26.224999999999998 24.7 24 22.95 24.025 26.674999999999997 26.35 25 24.525 25.324999999999996 24.525 25.624999999999996 26 22.7 24.675 26.974999999999998 25.650000000000002 27 25.25 22.075 26.174999999999997 26.5 28 23.775 24.05 24.75 27.425 29 22.5 24.65 26.375 26.474999999999998 30 22.525000000000002 23.474999999999998 27.0 27.0 31 25.424999999999997 24.275 24.325 25.974999999999998 32 22.6 26.55 24.925 25.924999999999997 33 23.799999999999997 23.925 26.450000000000003 25.825 34 23.1 24.45 24.8 27.650000000000002 35 23.474999999999998 24.875 25.424999999999997 26.224999999999998 36 23.125 24.175 26.275 26.424999999999997 37 23.7 24.125 25.2 26.974999999999998 38 23.175 25.474999999999998 27.1 24.25 39 23.9 23.400000000000002 25.85 26.85 40 23.775 25.3 25.0 25.924999999999997 41 22.5 25.374999999999996 26.0 26.125 42 22.125 23.875 26.424999999999997 27.575 43 23.825 24.275 25.35 26.55 44 23.625 25.374999999999996 26.1 24.9 45 23.175 24.85 23.95 28.025 46 25.874999999999996 24.0 23.625 26.5 47 23.425 24.8 26.6 25.174999999999997 48 24.0 24.099999999999998 25.1 26.8 49 24.025 24.075 25.25 26.650000000000002 50 23.25 24.375 27.450000000000003 24.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 5.0 24 9.0 25 8.5 26 8.0 27 10.5 28 13.0 29 26.5 30 40.0 31 55.0 32 70.0 33 86.0 34 102.0 35 119.0 36 136.0 37 157.5 38 179.0 39 229.5 40 280.0 41 287.0 42 294.0 43 304.5 44 315.0 45 325.0 46 335.0 47 336.0 48 337.0 49 305.5 50 274.0 51 276.5 52 279.0 53 244.0 54 209.0 55 196.0 56 183.0 57 175.0 58 167.0 59 135.5 60 104.0 61 113.0 62 122.0 63 112.5 64 103.0 65 107.5 66 112.0 67 94.0 68 76.0 69 76.5 70 77.0 71 63.0 72 49.0 73 47.5 74 46.0 75 36.5 76 27.0 77 23.5 78 20.0 79 18.5 80 17.0 81 13.0 82 9.0 83 6.0 84 3.0 85 2.5 86 2.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 3.7249999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.6822187662001 93.25 2 3.0585795749092792 5.8999999999999995 3 0.23328149300155523 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02592016588906169 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196643 READS because READLEN < 1 Read 1196643 spots for SRR6322427.sra Written 1196643 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra Rejected 1196625 READS because READLEN < 1 Read 1196625 spots for SRR6322427.sra Written 1196625 spots for SRR6322427.sra SRR ids: ['SRR6322427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vntekfd3 SRR6322427.sra spots: 23932518 blocks: [[1, 1196625], [1196626, 2393250], [2393251, 3589875], [3589876, 4786500], [4786501, 5983125], [5983126, 7179750], [7179751, 8376375], [8376376, 9573000], [9573001, 10769625], [10769626, 11966250], [11966251, 13162875], [13162876, 14359500], [14359501, 15556125], [15556126, 16752750], [16752751, 17949375], [17949376, 19146000], [19146001, 20342625], [20342626, 21539250], [21539251, 22735875], [22735876, 23932518]] SRR6322427 file size 3343809 SRR6322427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322427 SRR6322427_1.fastq Input file: SRR6322427_1.fastq trimmed: SRR6322427-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:44:52 2024 >> started Sat Dec 7 10:45:06 2024 >> done (14.342s) 23932518 reads processed; of these: 39 ( 0.00%) short reads filtered out after trimming by size control 57780 ( 0.24%) empty reads filtered out after trimming by size control 23874699 (99.76%) reads available; of these: 20 ( 0.00%) trimmed reads available after processing 23874679 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 15 0.00% 50 23874679 100.00% 23874699 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=21 prefix-density=0.12 prefix-fanout=3.1 sequence=TCCTTGCCGTTCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=155.56 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=20.2 sequence=CTTCTTCTTCTC Started job on | Dec 07 10:45:17 Started mapping on | Dec 07 10:45:17 Finished on | Dec 07 10:45:34 Mapping speed, Million of reads per hour | 5055.82 Number of input reads | 23874699 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 22991431 Uniquely mapped reads % | 96.30% Average mapped length | 49.83 Number of splices: Total | 3472502 Number of splices: Annotated (sjdb) | 3342025 Number of splices: GT/AG | 3427340 Number of splices: GC/AG | 38113 Number of splices: AT/AC | 2568 Number of splices: Non-canonical | 4481 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 674553 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 68584 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 208715 208715 208715 N_multimapping 674553 674553 674553 N_noFeature 1052521 22500111 1228839 N_ambiguous 340592 1666 25983 UnstrandedReadsAssigned:21598318 PositiveStrandReadsAssigned:489654 NegativeStrandReadsAssigned:21736609 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322427 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322427-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,874,699 reads, 21,416,020 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,302 rounds 52973 SRR6322427.ke.tsv 35125 SRR6322427.se.tsv 88098 total ==> SRR6322427.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 60.9927 5.96971 PNS24247 1044 945 57.0079 4.94201 PNS24249 1928 1829 217.071 9.72272 PNS24246 1044 945 57.0079 4.94201 PNS24248 1044 945 57.0079 4.94201 PNS24244 1471 1372 83.913 5.01043 PNS24243 293 194 0 0 KQK14069 1603 1504 9158.92 498.881 KQK14071 474 375 1843.34 402.693 ==> SRR6322427.se.tsv <== BRADI_1g14170v3 11962 BRADI_1g53295v3 398 BRADI_1g59795v3 569 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 400 BRADI_1g74790v3 124 BRADI_1g09890v3 0 BRADI_1g77505v3 405 BRADI_1g48960v3 0 SRR6322427 completed mapping pipeline successfully