Starting /dee2/code/volunteer_pipeline.sh SRR6322428 current disk space = 1543373246464 free memory = 1603224136 SRR6322428 SRAfilesize 43b72affa8354ffa6bf75f8da5d8d9ff SRR6322428.sra SRR6322428.sra file validated SRR6322428 is single end SRR6322428 is conventional basespace SRR6322428 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4925 32.0 32.0 32.0 32.0 32.0 2 30.19125 32.0 32.0 32.0 32.0 32.0 3 35.42375 37.0 32.0 37.0 32.0 37.0 4 34.55375 37.0 37.0 37.0 32.0 37.0 5 35.7775 37.0 37.0 37.0 32.0 37.0 6 40.039 41.0 41.0 41.0 37.0 41.0 7 40.27475 41.0 41.0 41.0 37.0 41.0 8 40.351 41.0 41.0 41.0 41.0 41.0 9 40.10875 41.0 41.0 41.0 37.0 41.0 10 40.2365 41.0 41.0 41.0 41.0 41.0 11 38.98 41.0 41.0 41.0 37.0 41.0 12 39.96025 41.0 41.0 41.0 37.0 41.0 13 40.2265 41.0 41.0 41.0 37.0 41.0 14 40.42975 41.0 41.0 41.0 41.0 41.0 15 39.59225 41.0 41.0 41.0 37.0 41.0 16 39.47125 41.0 41.0 41.0 37.0 41.0 17 40.213 41.0 41.0 41.0 37.0 41.0 18 40.3115 41.0 41.0 41.0 41.0 41.0 19 40.271 41.0 41.0 41.0 41.0 41.0 20 39.65775 41.0 41.0 41.0 37.0 41.0 21 38.07425 41.0 37.0 41.0 32.0 41.0 22 39.80075 41.0 41.0 41.0 37.0 41.0 23 37.75375 41.0 37.0 41.0 27.0 41.0 24 39.47625 41.0 41.0 41.0 37.0 41.0 25 39.57875 41.0 41.0 41.0 37.0 41.0 26 38.127 41.0 37.0 41.0 32.0 41.0 27 33.8375 41.0 27.0 41.0 12.0 41.0 28 35.3835 41.0 32.0 41.0 22.0 41.0 29 38.948 41.0 41.0 41.0 37.0 41.0 30 39.3305 41.0 41.0 41.0 37.0 41.0 31 38.978 41.0 41.0 41.0 37.0 41.0 32 38.5885 41.0 41.0 41.0 32.0 41.0 33 32.598 37.0 27.0 41.0 12.0 41.0 34 37.542 41.0 37.0 41.0 27.0 41.0 35 38.9125 41.0 41.0 41.0 32.0 41.0 36 39.7035 41.0 41.0 41.0 37.0 41.0 37 39.68825 41.0 41.0 41.0 37.0 41.0 38 38.4915 41.0 41.0 41.0 32.0 41.0 39 38.43725 41.0 41.0 41.0 32.0 41.0 40 38.90875 41.0 41.0 41.0 37.0 41.0 41 39.35975 41.0 41.0 41.0 37.0 41.0 42 39.51775 41.0 41.0 41.0 37.0 41.0 43 39.65125 41.0 41.0 41.0 37.0 41.0 44 38.885 41.0 41.0 41.0 37.0 41.0 45 38.93975 41.0 41.0 41.0 37.0 41.0 46 32.44125 37.0 27.0 41.0 12.0 41.0 47 36.8685 41.0 37.0 41.0 27.0 41.0 48 37.66075 41.0 37.0 41.0 27.0 41.0 49 39.40675 41.0 41.0 41.0 37.0 41.0 50 39.6305 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 7.0 26 9.0 27 15.0 28 16.0 29 25.0 30 38.0 31 75.0 32 67.0 33 90.0 34 150.0 35 168.0 36 236.0 37 333.0 38 492.0 39 1023.0 40 1255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.272136068034015 10.680340170085042 6.353176588294147 38.6943471735868 2 25.37235432453619 11.366605696367913 33.73399529657695 29.527044682518945 3 20.674999999999997 16.05 24.4 38.875 4 26.075 21.125 22.6 30.2 5 28.15 25.324999999999996 23.674999999999997 22.85 6 23.974999999999998 28.999999999999996 23.95 23.075000000000003 7 19.35 23.925 37.625 19.1 8 19.025 24.575 29.725 26.674999999999997 9 18.05 22.175 33.45 26.325 10 20.95 32.225 26.575 20.25 11 26.5 22.6 23.05 27.85 12 24.025 22.3 26.775 26.900000000000002 13 23.1 24.675 26.85 25.374999999999996 14 22.3 25.374999999999996 26.075 26.25 15 23.150000000000002 24.15 25.724999999999998 26.974999999999998 16 23.1 24.525 25.575 26.8 17 24.025 24.825 24.8 26.35 18 23.325000000000003 24.95 26.0 25.724999999999998 19 23.75 24.85 25.374999999999996 26.025 20 23.599999999999998 25.45 25.074999999999996 25.874999999999996 21 22.900000000000002 25.15 26.075 25.874999999999996 22 25.2 25.55 23.724999999999998 25.525 23 24.099999999999998 24.3 26.3 25.3 24 22.05 25.1 25.424999999999997 27.425 25 22.275 24.349999999999998 25.95 27.425 26 23.0 24.125 26.025 26.85 27 24.825 23.849999999999998 25.374999999999996 25.95 28 24.925 24.775 25.224999999999998 25.074999999999996 29 23.150000000000002 25.074999999999996 25.474999999999998 26.3 30 23.474999999999998 24.775 25.0 26.75 31 23.45 25.85 25.6 25.1 32 23.0 25.224999999999998 26.825 24.95 33 25.5 24.4 25.8 24.3 34 23.974999999999998 25.0 23.9 27.125 35 24.425 24.95 25.275 25.35 36 23.25 24.275 25.0 27.474999999999998 37 23.45 26.0 24.525 26.025 38 23.75 24.65 25.6 26.0 39 22.5 24.925 25.85 26.724999999999998 40 24.325 25.15 23.549999999999997 26.974999999999998 41 23.925 25.15 25.874999999999996 25.05 42 24.474999999999998 24.075 25.424999999999997 26.025 43 23.625 24.675 25.900000000000002 25.8 44 23.5 25.900000000000002 24.325 26.275 45 23.65 23.75 26.25 26.35 46 27.425 23.0 24.125 25.45 47 24.175 24.625 24.8 26.400000000000002 48 24.3 25.0 25.650000000000002 25.05 49 23.400000000000002 24.925 24.675 27.0 50 23.825 24.224999999999998 25.474999999999998 26.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 2.0 22 4.0 23 4.5 24 5.0 25 7.5 26 10.0 27 10.0 28 10.0 29 20.5 30 31.0 31 35.5 32 40.0 33 67.0 34 94.0 35 107.5 36 121.0 37 157.0 38 193.0 39 213.5 40 234.0 41 257.0 42 280.0 43 301.5 44 323.0 45 347.0 46 371.0 47 352.5 48 334.0 49 315.5 50 297.0 51 286.0 52 275.0 53 252.0 54 229.0 55 203.0 56 177.0 57 156.0 58 135.0 59 127.5 60 120.0 61 130.5 62 141.0 63 118.5 64 96.0 65 102.5 66 109.0 67 105.0 68 101.0 69 90.0 70 79.0 71 61.5 72 44.0 73 49.0 74 54.0 75 45.0 76 36.0 77 31.5 78 27.0 79 20.0 80 13.0 81 11.5 82 10.0 83 5.0 84 0.0 85 1.5 86 3.0 87 2.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 4.324999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.40998959417274 92.65 2 3.1737773152965656 6.1 3 0.36420395421436 1.05 4 0.052029136316337155 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401118 READS because READLEN < 1 Read 1401118 spots for SRR6322428.sra Written 1401118 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra Rejected 1401110 READS because READLEN < 1 Read 1401110 spots for SRR6322428.sra Written 1401110 spots for SRR6322428.sra SRR ids: ['SRR6322428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9tyx38l4 SRR6322428.sra spots: 28022208 blocks: [[1, 1401110], [1401111, 2802220], [2802221, 4203330], [4203331, 5604440], [5604441, 7005550], [7005551, 8406660], [8406661, 9807770], [9807771, 11208880], [11208881, 12609990], [12609991, 14011100], [14011101, 15412210], [15412211, 16813320], [16813321, 18214430], [18214431, 19615540], [19615541, 21016650], [21016651, 22417760], [22417761, 23818870], [23818871, 25219980], [25219981, 26621090], [26621091, 28022208]] SRR6322428 file size 3918922 SRR6322428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322428 SRR6322428_1.fastq Input file: SRR6322428_1.fastq trimmed: SRR6322428-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:45:18 2024 >> started Sat Dec 7 10:45:39 2024 >> done (20.611s) 28022208 reads processed; of these: 61 ( 0.00%) short reads filtered out after trimming by size control 17999 ( 0.06%) empty reads filtered out after trimming by size control 28004148 (99.94%) reads available; of these: 16 ( 0.00%) trimmed reads available after processing 28004132 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 6 0.00% 50 28004132 100.00% 28004148 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=17 prefix-density=0.09 prefix-fanout=3.3 sequence=TCCTTGCCGTTCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=121.99 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=16.2 sequence=CGCCGCCGCCGCG Started job on | Dec 07 10:45:52 Started mapping on | Dec 07 10:46:01 Finished on | Dec 07 10:46:21 Mapping speed, Million of reads per hour | 5040.75 Number of input reads | 28004148 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26965283 Uniquely mapped reads % | 96.29% Average mapped length | 49.80 Number of splices: Total | 3863886 Number of splices: Annotated (sjdb) | 3742728 Number of splices: GT/AG | 3813940 Number of splices: GC/AG | 43065 Number of splices: AT/AC | 2713 Number of splices: Non-canonical | 4168 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 740295 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 109591 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298570 298570 298570 N_multimapping 740295 740295 740295 N_noFeature 1085721 26393287 1283867 N_ambiguous 399442 2038 25898 UnstrandedReadsAssigned:25480120 PositiveStrandReadsAssigned:569958 NegativeStrandReadsAssigned:25655518 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322428 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322428-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,004,148 reads, 25,224,061 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6322428.ke.tsv 35125 SRR6322428.se.tsv 88098 total ==> SRR6322428.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.87064e-06 6.53518e-07 PNS24247 1044 945 61.5672 4.52783 PNS24249 1928 1829 419.086 15.9244 PNS24246 1044 945 61.5672 4.52783 PNS24248 1044 945 61.5672 4.52783 PNS24244 1471 1372 28.2127 1.4291 PNS24243 293 194 0 0 KQK14069 1603 1504 6319.76 292.029 KQK14071 474 375 821.409 152.23 ==> SRR6322428.se.tsv <== BRADI_1g14170v3 7577 BRADI_1g53295v3 302 BRADI_1g59795v3 439 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 502 BRADI_1g74790v3 452 BRADI_1g09890v3 0 BRADI_1g77505v3 430 BRADI_1g48960v3 1 SRR6322428 completed mapping pipeline successfully