Starting /dee2/code/volunteer_pipeline.sh SRR6322429 current disk space = 1543363731456 free memory = 1603214140 SRR6322429 SRAfilesize 16ab7b2d405dca0e253c6bb610314e05 SRR6322429.sra SRR6322429.sra file validated SRR6322429 is single end SRR6322429 is conventional basespace SRR6322429 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5025 32.0 32.0 32.0 32.0 32.0 2 29.9825 32.0 32.0 32.0 32.0 32.0 3 35.35125 37.0 32.0 37.0 32.0 37.0 4 34.57125 37.0 37.0 37.0 32.0 37.0 5 35.75375 37.0 37.0 37.0 32.0 37.0 6 40.1425 41.0 41.0 41.0 37.0 41.0 7 40.35075 41.0 41.0 41.0 37.0 41.0 8 40.38425 41.0 41.0 41.0 41.0 41.0 9 40.02375 41.0 41.0 41.0 37.0 41.0 10 40.24575 41.0 41.0 41.0 37.0 41.0 11 38.80925 41.0 41.0 41.0 32.0 41.0 12 39.8985 41.0 41.0 41.0 37.0 41.0 13 40.18 41.0 41.0 41.0 37.0 41.0 14 40.38375 41.0 41.0 41.0 41.0 41.0 15 39.45575 41.0 41.0 41.0 37.0 41.0 16 39.4855 41.0 41.0 41.0 37.0 41.0 17 40.2745 41.0 41.0 41.0 37.0 41.0 18 40.33375 41.0 41.0 41.0 41.0 41.0 19 40.22025 41.0 41.0 41.0 41.0 41.0 20 39.79825 41.0 41.0 41.0 37.0 41.0 21 37.7725 41.0 37.0 41.0 27.0 41.0 22 39.78125 41.0 41.0 41.0 37.0 41.0 23 37.74425 41.0 37.0 41.0 27.0 41.0 24 39.49975 41.0 41.0 41.0 37.0 41.0 25 39.62225 41.0 41.0 41.0 37.0 41.0 26 38.37325 41.0 41.0 41.0 32.0 41.0 27 33.3785 41.0 27.0 41.0 12.0 41.0 28 35.26475 41.0 32.0 41.0 22.0 41.0 29 38.944 41.0 37.0 41.0 37.0 41.0 30 39.2125 41.0 41.0 41.0 37.0 41.0 31 38.94575 41.0 41.0 41.0 37.0 41.0 32 38.57075 41.0 41.0 41.0 32.0 41.0 33 32.25775 37.0 27.0 41.0 12.0 41.0 34 37.48775 41.0 37.0 41.0 27.0 41.0 35 38.878 41.0 41.0 41.0 37.0 41.0 36 39.795 41.0 41.0 41.0 37.0 41.0 37 39.759 41.0 41.0 41.0 37.0 41.0 38 38.41575 41.0 41.0 41.0 32.0 41.0 39 38.318 41.0 41.0 41.0 32.0 41.0 40 38.845 41.0 41.0 41.0 32.0 41.0 41 39.14675 41.0 41.0 41.0 37.0 41.0 42 39.48825 41.0 41.0 41.0 37.0 41.0 43 39.6185 41.0 41.0 41.0 37.0 41.0 44 38.73225 41.0 41.0 41.0 32.0 41.0 45 38.85425 41.0 41.0 41.0 37.0 41.0 46 32.0725 37.0 27.0 41.0 12.0 41.0 47 36.7785 41.0 37.0 41.0 27.0 41.0 48 37.78725 41.0 37.0 41.0 27.0 41.0 49 39.42925 41.0 41.0 41.0 37.0 41.0 50 39.72125 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 6.0 26 12.0 27 4.0 28 28.0 29 25.0 30 39.0 31 59.0 32 69.0 33 110.0 34 123.0 35 201.0 36 226.0 37 343.0 38 562.0 39 1045.0 40 1146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.46011502875719 8.477119279819954 4.776194048512128 46.28657164291073 2 21.503680336487907 10.46267087276551 38.90641430073607 29.12723449001052 3 22.075 12.875 24.8 40.25 4 26.924999999999997 19.175 19.875 34.025 5 27.975 25.0 23.425 23.599999999999998 6 23.775 28.499999999999996 23.7 24.025 7 18.975 24.55 38.675 17.8 8 18.075 22.85 35.099999999999994 23.974999999999998 9 20.200000000000003 19.575 36.125 24.099999999999998 10 22.25 32.25 26.625 18.875 11 25.624999999999996 24.474999999999998 24.075 25.825 12 23.95 21.175 27.200000000000003 27.675 13 24.2 23.95 26.875 24.975 14 23.775 23.625 27.150000000000002 25.45 15 22.95 25.1 27.55 24.4 16 23.075000000000003 24.425 24.875 27.625 17 24.099999999999998 24.675 26.075 25.15 18 23.724999999999998 23.474999999999998 26.35 26.450000000000003 19 24.625 24.075 23.125 28.175 20 22.7 24.0 27.750000000000004 25.55 21 24.975 22.975 25.374999999999996 26.674999999999997 22 23.425 25.0 25.25 26.325 23 23.974999999999998 25.074999999999996 25.424999999999997 25.525 24 22.275 23.549999999999997 26.424999999999997 27.750000000000004 25 24.125 23.25 26.0 26.625 26 22.425 24.125 26.650000000000002 26.8 27 24.375 23.7 24.2 27.725 28 24.375 24.55 23.974999999999998 27.1 29 24.349999999999998 25.35 25.575 24.725 30 22.5 24.375 25.95 27.175 31 24.275 23.724999999999998 25.124999999999996 26.875 32 23.925 24.375 26.85 24.85 33 25.924999999999997 22.125 24.3 27.650000000000002 34 24.325 23.175 25.75 26.75 35 24.2 24.3 25.900000000000002 25.6 36 23.7 22.925 24.725 28.65 37 23.5 24.349999999999998 26.275 25.874999999999996 38 23.175 26.200000000000003 26.125 24.5 39 23.5 22.325 26.400000000000002 27.775 40 23.625 25.174999999999997 24.15 27.05 41 23.599999999999998 24.575 26.724999999999998 25.1 42 24.375 23.35 24.85 27.425 43 24.7 24.525 24.075 26.700000000000003 44 22.675 25.124999999999996 26.85 25.35 45 24.275 23.45 26.025 26.25 46 26.724999999999998 23.175 24.7 25.4 47 23.075000000000003 26.275 25.674999999999997 24.975 48 23.875 23.549999999999997 25.275 27.3 49 25.775 24.175 23.925 26.125 50 23.0 24.9 26.0 26.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 6.0 26 9.0 27 12.5 28 16.0 29 26.0 30 36.0 31 42.0 32 48.0 33 72.0 34 96.0 35 106.5 36 117.0 37 144.5 38 172.0 39 206.5 40 241.0 41 264.5 42 288.0 43 310.5 44 333.0 45 330.5 46 328.0 47 316.0 48 304.0 49 290.5 50 277.0 51 262.0 52 247.0 53 242.0 54 237.0 55 216.0 56 195.0 57 181.5 58 168.0 59 164.0 60 160.0 61 145.5 62 131.0 63 121.0 64 111.0 65 113.0 66 115.0 67 102.0 68 89.0 69 86.0 70 83.0 71 71.0 72 59.0 73 48.0 74 37.0 75 37.0 76 37.0 77 30.0 78 23.0 79 20.5 80 18.0 81 15.0 82 12.0 83 10.0 84 8.0 85 4.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 4.9 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.9296218487395 91.325 2 3.650210084033614 6.950000000000001 3 0.3676470588235294 1.05 4 0.0 0.0 5 0.026260504201680673 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026260504201680673 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 22 0.5499999999999999 TruSeq Adapter, Index 11 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGGATGC 5 0.125 TruSeq Adapter, Index 11 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451430 READS because READLEN < 1 Read 1451430 spots for SRR6322429.sra Written 1451430 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra Rejected 1451423 READS because READLEN < 1 Read 1451423 spots for SRR6322429.sra Written 1451423 spots for SRR6322429.sra SRR ids: ['SRR6322429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_57o5vg21 SRR6322429.sra spots: 29028467 blocks: [[1, 1451423], [1451424, 2902846], [2902847, 4354269], [4354270, 5805692], [5805693, 7257115], [7257116, 8708538], [8708539, 10159961], [10159962, 11611384], [11611385, 13062807], [13062808, 14514230], [14514231, 15965653], [15965654, 17417076], [17417077, 18868499], [18868500, 20319922], [20319923, 21771345], [21771346, 23222768], [23222769, 24674191], [24674192, 26125614], [26125615, 27577037], [27577038, 29028467]] SRR6322429 file size 4060427 SRR6322429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322429 SRR6322429_1.fastq Input file: SRR6322429_1.fastq trimmed: SRR6322429-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:45:31 2024 >> started Sat Dec 7 10:45:43 2024 >> done (11.498s) 29028467 reads processed; of these: 52 ( 0.00%) short reads filtered out after trimming by size control 235489 ( 0.81%) empty reads filtered out after trimming by size control 28792926 (99.19%) reads available; of these: 24 ( 0.00%) trimmed reads available after processing 28792902 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 14 0.00% 50 28792902 100.00% 28792926 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=19 prefix-density=0.13 prefix-fanout=2.8 sequence=TCCTTGCCGTTCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=369.35 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=13.2 sequence=CCGCCGCCGCGCCGACCTCCTCCGCGATCTTGTGCCTGTGCGCGTTTTCCGGGTCCTTCTTTGCCTCGTGCTTCTCGTAGAGGGCGAAGGC Started job on | Dec 07 10:46:11 Started mapping on | Dec 07 10:46:11 Finished on | Dec 07 10:46:39 Mapping speed, Million of reads per hour | 3701.95 Number of input reads | 28792926 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 27723907 Uniquely mapped reads % | 96.29% Average mapped length | 49.82 Number of splices: Total | 4030296 Number of splices: Annotated (sjdb) | 3888394 Number of splices: GT/AG | 3977650 Number of splices: GC/AG | 44912 Number of splices: AT/AC | 2941 Number of splices: Non-canonical | 4793 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 767364 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 83723 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 301655 301655 301655 N_multimapping 767364 767364 767364 N_noFeature 1279017 27116994 1504484 N_ambiguous 412677 1893 31634 UnstrandedReadsAssigned:26032213 PositiveStrandReadsAssigned:605020 NegativeStrandReadsAssigned:26187789 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322429 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322429-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,792,926 reads, 25,758,824 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52973 SRR6322429.ke.tsv 35125 SRR6322429.se.tsv 88098 total ==> SRR6322429.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.00300297 0.00024483 PNS24247 1044 945 116.039 8.37938 PNS24249 1928 1829 352.808 13.1633 PNS24246 1044 945 116.039 8.37938 PNS24248 1044 945 116.039 8.37938 PNS24244 1471 1372 62.071 3.08726 PNS24243 293 194 2 0.703505 KQK14069 1603 1504 11926.7 541.142 KQK14071 474 375 2884.25 524.857 ==> SRR6322429.se.tsv <== BRADI_1g14170v3 15839 BRADI_1g53295v3 478 BRADI_1g59795v3 689 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 504 BRADI_1g74790v3 156 BRADI_1g09890v3 0 BRADI_1g77505v3 389 BRADI_1g48960v3 0 SRR6322429 completed mapping pipeline successfully