Starting /dee2/code/volunteer_pipeline.sh SRR6322430 current disk space = 1543126925312 free memory = 1604151588 SRR6322430 SRAfilesize 80deb0b28d8689a38562c0f9d2221f74 SRR6322430.sra SRR6322430.sra file validated SRR6322430 is single end SRR6322430 is conventional basespace SRR6322430 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49 32.0 32.0 32.0 32.0 32.0 2 30.0375 32.0 32.0 32.0 32.0 32.0 3 35.3325 37.0 32.0 37.0 32.0 37.0 4 34.40625 37.0 37.0 37.0 27.0 37.0 5 35.79 37.0 37.0 37.0 32.0 37.0 6 40.07 41.0 41.0 41.0 37.0 41.0 7 40.25925 41.0 41.0 41.0 37.0 41.0 8 40.345 41.0 41.0 41.0 41.0 41.0 9 40.00125 41.0 41.0 41.0 37.0 41.0 10 40.24825 41.0 41.0 41.0 41.0 41.0 11 38.84725 41.0 41.0 41.0 37.0 41.0 12 39.94175 41.0 41.0 41.0 37.0 41.0 13 40.275 41.0 41.0 41.0 37.0 41.0 14 40.41575 41.0 41.0 41.0 41.0 41.0 15 39.487 41.0 41.0 41.0 37.0 41.0 16 39.4415 41.0 41.0 41.0 37.0 41.0 17 40.26475 41.0 41.0 41.0 37.0 41.0 18 40.34075 41.0 41.0 41.0 41.0 41.0 19 40.283 41.0 41.0 41.0 41.0 41.0 20 39.80625 41.0 41.0 41.0 37.0 41.0 21 37.9525 41.0 37.0 41.0 27.0 41.0 22 39.7395 41.0 41.0 41.0 37.0 41.0 23 37.67475 41.0 37.0 41.0 27.0 41.0 24 39.507 41.0 41.0 41.0 37.0 41.0 25 39.64575 41.0 41.0 41.0 37.0 41.0 26 38.0645 41.0 37.0 41.0 32.0 41.0 27 33.275 41.0 27.0 41.0 12.0 41.0 28 35.16275 41.0 32.0 41.0 22.0 41.0 29 38.81925 41.0 37.0 41.0 32.0 41.0 30 39.1745 41.0 41.0 41.0 37.0 41.0 31 38.79775 41.0 41.0 41.0 32.0 41.0 32 38.46375 41.0 41.0 41.0 32.0 41.0 33 32.04275 37.0 27.0 41.0 12.0 41.0 34 37.30825 41.0 37.0 41.0 27.0 41.0 35 38.866 41.0 41.0 41.0 37.0 41.0 36 39.84625 41.0 41.0 41.0 37.0 41.0 37 39.69575 41.0 41.0 41.0 37.0 41.0 38 38.444 41.0 41.0 41.0 32.0 41.0 39 38.23925 41.0 41.0 41.0 32.0 41.0 40 38.692 41.0 41.0 41.0 32.0 41.0 41 39.3175 41.0 41.0 41.0 37.0 41.0 42 39.47975 41.0 41.0 41.0 37.0 41.0 43 39.647 41.0 41.0 41.0 37.0 41.0 44 38.6935 41.0 41.0 41.0 32.0 41.0 45 38.901 41.0 41.0 41.0 37.0 41.0 46 31.98925 37.0 22.0 41.0 12.0 41.0 47 36.81975 41.0 37.0 41.0 27.0 41.0 48 37.59725 41.0 37.0 41.0 27.0 41.0 49 39.39875 41.0 41.0 41.0 37.0 41.0 50 39.689 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 3.0 26 10.0 27 11.0 28 28.0 29 20.0 30 39.0 31 51.0 32 84.0 33 95.0 34 139.0 35 203.0 36 218.0 37 390.0 38 575.0 39 1025.0 40 1105.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6591647911978 10.002500625156289 5.226306576644161 48.11202800700175 2 21.419185282522996 10.749014454664914 42.155059132720105 25.676741130091983 3 21.625 14.825 23.025000000000002 40.525 4 26.8 21.099999999999998 21.125 30.975 5 27.6 26.375 24.075 21.95 6 21.7 32.45 24.65 21.2 7 17.775 24.7 37.925 19.6 8 18.375 22.725 33.925 24.975 9 19.225 20.625 35.85 24.3 10 21.3 32.375 26.424999999999997 19.900000000000002 11 24.625 26.924999999999997 23.075000000000003 25.374999999999996 12 23.075000000000003 22.05 27.375 27.500000000000004 13 23.674999999999997 24.875 26.6 24.85 14 21.8 24.525 28.349999999999998 25.324999999999996 15 21.45 26.200000000000003 26.85 25.5 16 23.625 24.725 24.85 26.8 17 23.375 25.25 27.200000000000003 24.175 18 22.825 24.25 26.625 26.3 19 24.525 25.924999999999997 24.75 24.8 20 22.35 25.775 26.150000000000002 25.724999999999998 21 22.275 25.874999999999996 25.650000000000002 26.200000000000003 22 23.625 25.724999999999998 23.65 27.0 23 21.65 27.05 26.5 24.8 24 23.05 25.1 25.5 26.35 25 24.125 25.75 23.175 26.950000000000003 26 22.8 26.025 26.625 24.55 27 26.075 23.0 24.675 26.25 28 24.0 25.674999999999997 24.375 25.95 29 22.375 25.4 26.325 25.900000000000002 30 23.375 23.65 25.674999999999997 27.3 31 23.825 25.874999999999996 23.849999999999998 26.450000000000003 32 22.925 26.075 26.125 24.875 33 23.775 23.724999999999998 27.1 25.4 34 22.5 24.6 25.525 27.375 35 22.775000000000002 24.925 26.625 25.674999999999997 36 22.25 25.424999999999997 24.9 27.425 37 23.65 25.35 23.974999999999998 27.025 38 23.05 26.075 26.424999999999997 24.45 39 22.6 26.05 25.324999999999996 26.025 40 23.625 25.624999999999996 24.8 25.95 41 23.175 25.974999999999998 24.625 26.224999999999998 42 23.549999999999997 24.0 24.825 27.625 43 23.825 25.474999999999998 25.174999999999997 25.525 44 22.25 25.05 26.474999999999998 26.224999999999998 45 21.9 24.975 26.025 27.1 46 26.125 23.05 24.099999999999998 26.724999999999998 47 22.75 26.674999999999997 25.624999999999996 24.95 48 23.7 24.425 26.05 25.825 49 23.599999999999998 25.174999999999997 23.5 27.725 50 23.400000000000002 26.375 26.224999999999998 24.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 2.0 22 4.0 23 4.0 24 4.0 25 7.0 26 10.0 27 18.0 28 26.0 29 33.0 30 40.0 31 52.0 32 64.0 33 81.5 34 99.0 35 122.5 36 146.0 37 168.5 38 191.0 39 229.5 40 268.0 41 282.5 42 297.0 43 315.0 44 333.0 45 331.0 46 329.0 47 327.5 48 326.0 49 325.5 50 325.0 51 279.0 52 233.0 53 225.0 54 217.0 55 205.0 56 193.0 57 173.5 58 154.0 59 141.5 60 129.0 61 116.5 62 104.0 63 106.5 64 109.0 65 93.0 66 77.0 67 78.5 68 80.0 69 69.0 70 58.0 71 57.0 72 56.0 73 48.5 74 41.0 75 37.5 76 34.0 77 28.0 78 22.0 79 17.0 80 12.0 81 11.5 82 11.0 83 7.5 84 4.0 85 2.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 4.875 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.54455702779943 92.9 2 3.195635229929852 6.15 3 0.20784619381657576 0.6 4 0.02598077422707197 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02598077422707197 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 10 0.25 TruSeq Adapter, Index 10 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556356 READS because READLEN < 1 Read 1556356 spots for SRR6322430.sra Written 1556356 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra Rejected 1556346 READS because READLEN < 1 Read 1556346 spots for SRR6322430.sra Written 1556346 spots for SRR6322430.sra SRR ids: ['SRR6322430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8mjius47 SRR6322430.sra spots: 31126930 blocks: [[1, 1556346], [1556347, 3112692], [3112693, 4669038], [4669039, 6225384], [6225385, 7781730], [7781731, 9338076], [9338077, 10894422], [10894423, 12450768], [12450769, 14007114], [14007115, 15563460], [15563461, 17119806], [17119807, 18676152], [18676153, 20232498], [20232499, 21788844], [21788845, 23345190], [23345191, 24901536], [24901537, 26457882], [26457883, 28014228], [28014229, 29570574], [29570575, 31126930]] SRR6322430 file size 4355524 SRR6322430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322430 SRR6322430_1.fastq Input file: SRR6322430_1.fastq trimmed: SRR6322430-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:18:00 2024 >> started Sat Dec 7 12:18:20 2024 >> done (20.099s) 31126930 reads processed; of these: 60 ( 0.00%) short reads filtered out after trimming by size control 86717 ( 0.28%) empty reads filtered out after trimming by size control 31040153 (99.72%) reads available; of these: 25 ( 0.00%) trimmed reads available after processing 31040128 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 17 0.00% 50 31040128 100.00% 31040153 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=19 prefix-density=0.11 prefix-fanout=3.2 sequence=TCCTTGCCGTTCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=116.33 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.5 sequence=GCCGCCGCCGTA Started job on | Dec 07 12:18:30 Started mapping on | Dec 07 12:18:30 Finished on | Dec 07 12:18:58 Mapping speed, Million of reads per hour | 3990.88 Number of input reads | 31040153 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 29876973 Uniquely mapped reads % | 96.25% Average mapped length | 49.81 Number of splices: Total | 4383915 Number of splices: Annotated (sjdb) | 4234910 Number of splices: GT/AG | 4326881 Number of splices: GC/AG | 48834 Number of splices: AT/AC | 3199 Number of splices: Non-canonical | 5001 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 840537 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 112137 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322643 322643 322643 N_multimapping 840537 840537 840537 N_noFeature 1374541 29235188 1598652 N_ambiguous 450217 2188 32749 UnstrandedReadsAssigned:28052215 PositiveStrandReadsAssigned:639597 NegativeStrandReadsAssigned:28245572 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322430 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322430-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,040,153 reads, 27,778,682 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6322430.ke.tsv 35125 SRR6322430.se.tsv 88098 total ==> SRR6322430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 57.517 4.42531 PNS24247 1044 945 100.921 6.87736 PNS24249 1928 1829 377.421 13.2888 PNS24246 1044 945 100.921 6.87736 PNS24248 1044 945 100.921 6.87736 PNS24244 1471 1372 22.2994 1.04667 PNS24243 293 194 0 0 KQK14069 1603 1504 13907.7 595.5 KQK14071 474 375 2097.68 360.232 ==> SRR6322430.se.tsv <== BRADI_1g14170v3 16919 BRADI_1g53295v3 396 BRADI_1g59795v3 656 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 438 BRADI_1g74790v3 277 BRADI_1g09890v3 0 BRADI_1g77505v3 504 BRADI_1g48960v3 0 SRR6322430 completed mapping pipeline successfully