Starting /dee2/code/volunteer_pipeline.sh SRR6322433 current disk space = 1543365279744 free memory = 1596847280 SRR6322433 SRAfilesize aa92b7acdafacd03b837300fb937f99b SRR6322433.sra SRR6322433.sra file validated SRR6322433 is single end SRR6322433 is conventional basespace SRR6322433 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.9275 32.0 32.0 32.0 27.0 32.0 2 31.10625 32.0 32.0 32.0 32.0 32.0 3 34.99 37.0 32.0 37.0 32.0 37.0 4 35.67875 37.0 37.0 37.0 32.0 37.0 5 36.6175 37.0 37.0 37.0 37.0 37.0 6 40.0595 41.0 41.0 41.0 37.0 41.0 7 39.6725 41.0 41.0 41.0 37.0 41.0 8 39.6235 41.0 41.0 41.0 37.0 41.0 9 39.971 41.0 41.0 41.0 37.0 41.0 10 40.46925 41.0 41.0 41.0 41.0 41.0 11 40.28 41.0 41.0 41.0 37.0 41.0 12 40.362 41.0 41.0 41.0 41.0 41.0 13 40.2865 41.0 41.0 41.0 41.0 41.0 14 39.69575 41.0 41.0 41.0 37.0 41.0 15 39.65275 41.0 41.0 41.0 37.0 41.0 16 39.191 41.0 41.0 41.0 37.0 41.0 17 40.179 41.0 41.0 41.0 37.0 41.0 18 40.06 41.0 41.0 41.0 37.0 41.0 19 39.65975 41.0 41.0 41.0 37.0 41.0 20 39.3885 41.0 41.0 41.0 37.0 41.0 21 40.2685 41.0 41.0 41.0 41.0 41.0 22 39.8125 41.0 41.0 41.0 37.0 41.0 23 39.60075 41.0 41.0 41.0 37.0 41.0 24 39.69025 41.0 41.0 41.0 37.0 41.0 25 40.12 41.0 41.0 41.0 37.0 41.0 26 39.68975 41.0 41.0 41.0 37.0 41.0 27 39.921 41.0 41.0 41.0 37.0 41.0 28 38.8005 41.0 41.0 41.0 32.0 41.0 29 39.56475 41.0 41.0 41.0 37.0 41.0 30 39.75725 41.0 41.0 41.0 37.0 41.0 31 38.512 41.0 41.0 41.0 32.0 41.0 32 39.2215 41.0 41.0 41.0 37.0 41.0 33 38.304 41.0 41.0 41.0 32.0 41.0 34 39.25975 41.0 41.0 41.0 37.0 41.0 35 38.6865 41.0 41.0 41.0 32.0 41.0 36 39.501 41.0 41.0 41.0 37.0 41.0 37 38.7455 41.0 41.0 41.0 32.0 41.0 38 38.71 41.0 41.0 41.0 32.0 41.0 39 39.773 41.0 41.0 41.0 37.0 41.0 40 39.969 41.0 41.0 41.0 37.0 41.0 41 35.97225 41.0 37.0 41.0 22.0 41.0 42 38.57 41.0 41.0 41.0 32.0 41.0 43 39.50475 41.0 41.0 41.0 37.0 41.0 44 38.7515 41.0 41.0 41.0 32.0 41.0 45 33.65375 41.0 27.0 41.0 12.0 41.0 46 38.811 41.0 37.0 41.0 32.0 41.0 47 37.50825 41.0 37.0 41.0 27.0 41.0 48 37.39 41.0 37.0 41.0 27.0 41.0 49 37.38875 41.0 37.0 41.0 27.0 41.0 50 38.52225 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 3.0 25 1.0 26 6.0 27 9.0 28 17.0 29 31.0 30 48.0 31 63.0 32 75.0 33 70.0 34 103.0 35 146.0 36 174.0 37 223.0 38 362.0 39 848.0 40 1819.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.27945959469602 10.03252439329497 5.404053039779835 45.28396297222917 2 22.757390417940876 10.652395514780835 37.76758409785933 28.822629969418962 3 22.0 12.225 24.025 41.75 4 28.425 17.8 19.6 34.175 5 29.5 24.575 23.775 22.15 6 23.625 28.799999999999997 23.825 23.75 7 18.975 26.05 35.325 19.650000000000002 8 20.5 23.474999999999998 31.3 24.725 9 22.175 19.400000000000002 33.625 24.8 10 22.15 32.324999999999996 24.55 20.974999999999998 11 25.174999999999997 25.275 22.45 27.1 12 23.425 21.7 26.450000000000003 28.425 13 23.75 24.75 26.125 25.374999999999996 14 24.775 23.575 24.825 26.825 15 23.275000000000002 24.025 27.1 25.6 16 25.124999999999996 23.95 24.125 26.8 17 24.825 23.95 25.174999999999997 26.05 18 24.2 23.075000000000003 25.025 27.700000000000003 19 24.025 23.625 24.525 27.825 20 24.7 23.35 26.1 25.85 21 23.5 23.05 25.7 27.750000000000004 22 23.7 24.975 24.45 26.875 23 24.775 24.825 23.849999999999998 26.55 24 24.05 23.025000000000002 24.8 28.125 25 25.224999999999998 21.8 25.2 27.775 26 24.0 23.799999999999997 24.5 27.700000000000003 27 22.6 23.425 24.825 29.15 28 24.725 23.974999999999998 25.324999999999996 25.974999999999998 29 26.174999999999997 24.15 24.0 25.674999999999997 30 24.2 22.5 24.925 28.375 31 25.025 22.75 25.0 27.224999999999998 32 23.625 25.5 24.85 26.025 33 24.349999999999998 22.375 25.1 28.175 34 25.4 22.575 23.25 28.775000000000002 35 24.575 24.525 24.8 26.1 36 26.1 22.725 23.95 27.224999999999998 37 24.45 24.125 23.9 27.525 38 24.9 22.875 25.025 27.200000000000003 39 25.074999999999996 22.2 24.8 27.925 40 25.224999999999998 23.200000000000003 23.425 28.15 41 25.874999999999996 24.2 24.95 24.975 42 24.2 25.0 24.775 26.025 43 26.1 22.725 23.974999999999998 27.200000000000003 44 24.575 22.675 24.85 27.900000000000002 45 25.8 23.974999999999998 24.75 25.474999999999998 46 25.275 22.5 23.0 29.225 47 24.474999999999998 23.425 26.075 26.025 48 24.05 23.400000000000002 24.875 27.675 49 25.05 23.75 23.775 27.425 50 24.099999999999998 24.175 25.424999999999997 26.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 5.5 26 8.0 27 10.0 28 12.0 29 19.0 30 26.0 31 29.5 32 33.0 33 57.5 34 82.0 35 84.5 36 87.0 37 111.5 38 136.0 39 169.0 40 202.0 41 227.5 42 253.0 43 286.5 44 320.0 45 301.5 46 283.0 47 287.5 48 292.0 49 276.5 50 261.0 51 264.5 52 268.0 53 256.5 54 245.0 55 256.5 56 268.0 57 232.5 58 197.0 59 186.0 60 175.0 61 163.0 62 151.0 63 138.5 64 126.0 65 118.5 66 111.0 67 113.5 68 116.0 69 112.0 70 108.0 71 93.5 72 79.0 73 66.5 74 54.0 75 49.5 76 45.0 77 33.5 78 22.0 79 18.0 80 14.0 81 11.5 82 9.0 83 6.5 84 4.0 85 2.5 86 1.0 87 2.0 88 3.0 89 2.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 1.9 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.6 #Duplication Level Percentage of deduplicated Percentage of total 1 96.65271966527197 92.4 2 2.955020920502092 5.65 3 0.3138075313807531 0.8999999999999999 4 0.05230125523012552 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02615062761506276 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 34 0.8500000000000001 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573860 READS because READLEN < 1 Read 1573860 spots for SRR6322433.sra Written 1573860 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra Rejected 1573853 READS because READLEN < 1 Read 1573853 spots for SRR6322433.sra Written 1573853 spots for SRR6322433.sra SRR ids: ['SRR6322433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qb6y9e3t SRR6322433.sra spots: 31477067 blocks: [[1, 1573853], [1573854, 3147706], [3147707, 4721559], [4721560, 6295412], [6295413, 7869265], [7869266, 9443118], [9443119, 11016971], [11016972, 12590824], [12590825, 14164677], [14164678, 15738530], [15738531, 17312383], [17312384, 18886236], [18886237, 20460089], [20460090, 22033942], [22033943, 23607795], [23607796, 25181648], [25181649, 26755501], [26755502, 28329354], [28329355, 29903207], [29903208, 31477067]] SRR6322433 file size 4404762 SRR6322433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322433 SRR6322433_1.fastq Input file: SRR6322433_1.fastq trimmed: SRR6322433-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:45:16 2024 >> started Sat Dec 7 10:45:38 2024 >> done (21.895s) 31477067 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 376786 ( 1.20%) empty reads filtered out after trimming by size control 31100226 (98.80%) reads available; of these: 3824 ( 0.01%) trimmed reads available after processing 31096402 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3819 0.01% 50 31096402 99.99% 31100226 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=1.9 sequence=GGTGCCGGCGGAGTCCTATAAGCAACATCCGCCGATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=6 fanout-score=77.18 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=11.4 sequence=GCCGCCGCCGCCA Started job on | Dec 07 10:45:48 Started mapping on | Dec 07 10:45:48 Finished on | Dec 07 10:46:16 Mapping speed, Million of reads per hour | 3998.60 Number of input reads | 31100226 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 27723929 Uniquely mapped reads % | 89.14% Average mapped length | 49.81 Number of splices: Total | 4076972 Number of splices: Annotated (sjdb) | 3952266 Number of splices: GT/AG | 4024818 Number of splices: GC/AG | 44622 Number of splices: AT/AC | 2634 Number of splices: Non-canonical | 4898 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1378643 % of reads mapped to multiple loci | 4.43% Number of reads mapped to too many loci | 1698388 % of reads mapped to too many loci | 5.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1997654 1997654 1997654 N_multimapping 1378643 1378643 1378643 N_noFeature 879862 26918011 1031137 N_ambiguous 690866 1917 36471 UnstrandedReadsAssigned:26153201 PositiveStrandReadsAssigned:804001 NegativeStrandReadsAssigned:26656321 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322433 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322433-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,100,226 reads, 27,010,254 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR6322433.ke.tsv 35125 SRR6322433.se.tsv 88098 total ==> SRR6322433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 74.9015 5.06617 PNS24247 1044 945 29.9921 1.79676 PNS24249 1928 1829 448.127 13.8708 PNS24246 1044 945 29.9921 1.79676 PNS24248 1044 945 29.9921 1.79676 PNS24244 1471 1372 52.9951 2.18674 PNS24243 293 194 0 0 KQK14069 1603 1504 2806.23 105.631 KQK14071 474 375 660.524 99.7177 ==> SRR6322433.se.tsv <== BRADI_1g14170v3 3658 BRADI_1g53295v3 114 BRADI_1g59795v3 284 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 1728 BRADI_1g74790v3 195 BRADI_1g09890v3 56 BRADI_1g77505v3 509 BRADI_1g48960v3 3 SRR6322433 completed mapping pipeline successfully