Starting /dee2/code/volunteer_pipeline.sh SRR6322434 current disk space = 1543322382336 free memory = 1419289240 SRR6322434 SRAfilesize 9062fcac3abd6931c40831d1efcb1ac6 SRR6322434.sra SRR6322434.sra file validated SRR6322434 is single end SRR6322434 is conventional basespace SRR6322434 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49875 32.0 32.0 32.0 32.0 32.0 2 30.535 32.0 32.0 32.0 32.0 32.0 3 32.19125 32.0 32.0 37.0 27.0 37.0 4 35.975 37.0 37.0 37.0 32.0 37.0 5 35.925 37.0 37.0 37.0 32.0 37.0 6 40.11675 41.0 41.0 41.0 37.0 41.0 7 37.9045 41.0 37.0 41.0 32.0 41.0 8 40.06825 41.0 41.0 41.0 37.0 41.0 9 38.22275 41.0 37.0 41.0 32.0 41.0 10 40.325 41.0 41.0 41.0 37.0 41.0 11 40.55625 41.0 41.0 41.0 41.0 41.0 12 40.37475 41.0 41.0 41.0 41.0 41.0 13 39.6165 41.0 41.0 41.0 37.0 41.0 14 37.9505 41.0 37.0 41.0 32.0 41.0 15 39.57775 41.0 41.0 41.0 37.0 41.0 16 39.45575 41.0 41.0 41.0 37.0 41.0 17 40.3125 41.0 41.0 41.0 37.0 41.0 18 39.798 41.0 41.0 41.0 37.0 41.0 19 40.3715 41.0 41.0 41.0 41.0 41.0 20 40.04425 41.0 41.0 41.0 37.0 41.0 21 40.1605 41.0 41.0 41.0 37.0 41.0 22 40.39125 41.0 41.0 41.0 41.0 41.0 23 39.77525 41.0 41.0 41.0 37.0 41.0 24 37.18275 41.0 37.0 41.0 27.0 41.0 25 37.24075 41.0 37.0 41.0 27.0 41.0 26 37.197 41.0 37.0 41.0 27.0 41.0 27 39.279 41.0 41.0 41.0 37.0 41.0 28 37.232 41.0 37.0 41.0 27.0 41.0 29 37.57325 41.0 37.0 41.0 27.0 41.0 30 38.21125 41.0 37.0 41.0 32.0 41.0 31 33.69 37.0 27.0 41.0 12.0 41.0 32 33.73725 37.0 27.0 41.0 12.0 41.0 33 34.866 37.0 32.0 41.0 22.0 41.0 34 30.299 37.0 22.0 41.0 12.0 41.0 35 37.7925 41.0 37.0 41.0 27.0 41.0 36 38.847 41.0 37.0 41.0 32.0 41.0 37 33.33475 37.0 27.0 41.0 12.0 41.0 38 38.379 41.0 37.0 41.0 32.0 41.0 39 39.60875 41.0 41.0 41.0 37.0 41.0 40 39.1805 41.0 41.0 41.0 37.0 41.0 41 39.06425 41.0 41.0 41.0 37.0 41.0 42 39.60575 41.0 41.0 41.0 37.0 41.0 43 39.0605 41.0 41.0 41.0 37.0 41.0 44 39.97275 41.0 41.0 41.0 37.0 41.0 45 39.534 41.0 41.0 41.0 37.0 41.0 46 38.63225 41.0 41.0 41.0 32.0 41.0 47 37.4965 41.0 37.0 41.0 27.0 41.0 48 39.28475 41.0 41.0 41.0 37.0 41.0 49 39.544 41.0 41.0 41.0 37.0 41.0 50 38.097 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 6.0 27 11.0 28 18.0 29 28.0 30 43.0 31 58.0 32 77.0 33 104.0 34 144.0 35 210.0 36 311.0 37 483.0 38 716.0 39 1075.0 40 710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.14643304130163 10.81351689612015 4.956195244055069 47.08385481852315 2 21.961894953656024 10.427394438722965 39.727085478887744 27.883625128733264 3 21.425 13.600000000000001 23.9 41.075 4 28.799999999999997 19.2 20.599999999999998 31.4 5 29.15 24.725 23.025000000000002 23.1 6 25.275 28.349999999999998 21.975 24.4 7 22.225 24.575 32.475 20.724999999999998 8 20.275000000000002 23.0 31.724999999999998 25.0 9 20.3 20.025000000000002 35.075 24.6 10 23.875 29.075 26.1 20.95 11 26.1 22.900000000000002 23.724999999999998 27.275 12 24.125 20.9 25.85 29.125 13 25.974999999999998 23.05 24.8 26.174999999999997 14 25.324999999999996 22.85 25.724999999999998 26.1 15 23.674999999999997 23.625 24.975 27.725 16 26.075 23.7 22.45 27.775 17 25.324999999999996 23.400000000000002 23.474999999999998 27.800000000000004 18 24.9 23.225 23.75 28.125 19 27.474999999999998 23.474999999999998 22.825 26.224999999999998 20 24.775 25.275 23.799999999999997 26.150000000000002 21 24.2 24.075 23.525 28.199999999999996 22 26.775 23.375 22.025 27.825 23 24.375 24.925 24.15 26.55 24 24.05 23.474999999999998 24.025 28.449999999999996 25 26.825 23.325000000000003 22.2 27.650000000000002 26 26.200000000000003 23.3 24.15 26.35 27 24.025 24.25 24.224999999999998 27.500000000000004 28 24.525 23.974999999999998 23.35 28.15 29 26.0 24.325 23.825 25.85 30 25.275 23.200000000000003 24.4 27.125 31 27.650000000000002 23.200000000000003 22.6 26.55 32 26.0 25.7 23.849999999999998 24.45 33 25.275 22.0 24.125 28.599999999999998 34 26.8 21.725 23.799999999999997 27.675 35 24.75 23.375 25.900000000000002 25.974999999999998 36 24.925 23.025000000000002 23.775 28.275 37 28.525 21.625 22.75 27.1 38 24.45 24.525 23.9 27.125 39 25.624999999999996 23.525 23.325000000000003 27.525 40 27.400000000000002 23.175 23.45 25.974999999999998 41 25.650000000000002 22.900000000000002 25.05 26.400000000000002 42 26.375 23.549999999999997 23.775 26.3 43 27.200000000000003 22.95 22.725 27.125 44 26.0 23.0 23.125 27.875 45 24.825 23.05 23.200000000000003 28.925 46 26.200000000000003 22.35 22.6 28.849999999999998 47 25.374999999999996 23.3 23.125 28.199999999999996 48 25.874999999999996 23.225 22.925 27.975 49 25.900000000000002 24.05 23.225 26.825 50 25.525 23.849999999999998 23.875 26.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 5.0 24 7.0 25 6.5 26 6.0 27 9.0 28 12.0 29 15.0 30 18.0 31 32.0 32 46.0 33 54.5 34 63.0 35 81.5 36 100.0 37 122.5 38 145.0 39 166.5 40 188.0 41 205.5 42 223.0 43 236.0 44 249.0 45 271.0 46 293.0 47 262.5 48 232.0 49 250.0 50 268.0 51 264.0 52 260.0 53 256.0 54 252.0 55 215.5 56 179.0 57 176.5 58 174.0 59 187.0 60 200.0 61 212.0 62 224.0 63 195.0 64 166.0 65 161.5 66 157.0 67 155.5 68 154.0 69 135.5 70 117.0 71 110.5 72 104.0 73 84.5 74 65.0 75 57.5 76 50.0 77 37.0 78 24.0 79 17.0 80 10.0 81 8.0 82 6.0 83 4.5 84 3.0 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 2.9000000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.12649800266311 89.3 2 3.9946737683089215 7.5 3 0.4793608521970706 1.35 4 0.18641810918774968 0.7000000000000001 5 0.07989347536617843 0.375 6 0.10652463382157124 0.6 7 0.02663115845539281 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAACTCAAACCCACAAATAACACACCGTAATCTTCCTCTCCGTAAGA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (100% over 50bp) GTGGAAGTCGGCGGAGGGGTCGAACCAGAGGTAGAACTGGTGCTCCTTCT 6 0.15 No Hit GTGGGGTTCCAGACGATCTTGTAGGTGTGGAAGTCGGCGGAGGGGTCGAA 6 0.15 No Hit CCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGA 6 0.15 No Hit CCCACAAATAACACACCGTAATCTTCCTCTCCGTAAGACTGTCGCGACTG 5 0.125 No Hit CTTTGGGGAAGCGCCAGCCGTCGGCGCAGTAGTTGTACGTCATGCAGGTG 5 0.125 No Hit CCGTAATCTTCCTCTCCGTAAGACTGTCGCGACTGCAACAATCAAACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216809 READS because READLEN < 1 Read 2216809 spots for SRR6322434.sra Written 2216809 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra Rejected 2216796 READS because READLEN < 1 Read 2216796 spots for SRR6322434.sra Written 2216796 spots for SRR6322434.sra SRR ids: ['SRR6322434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zze6fp_l SRR6322434.sra spots: 44335933 blocks: [[1, 2216796], [2216797, 4433592], [4433593, 6650388], [6650389, 8867184], [8867185, 11083980], [11083981, 13300776], [13300777, 15517572], [15517573, 17734368], [17734369, 19951164], [19951165, 22167960], [22167961, 24384756], [24384757, 26601552], [26601553, 28818348], [28818349, 31035144], [31035145, 33251940], [33251941, 35468736], [35468737, 37685532], [37685533, 39902328], [39902329, 42119124], [42119125, 44335933]] SRR6322434 file size 6213040 SRR6322434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322434 SRR6322434_1.fastq Input file: SRR6322434_1.fastq trimmed: SRR6322434-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:49:14 2024 >> started Sat Dec 7 10:50:52 2024 >> done (97.426s) 44335933 reads processed; of these: 105 ( 0.00%) short reads filtered out after trimming by size control 111473 ( 0.25%) empty reads filtered out after trimming by size control 44224355 (99.75%) reads available; of these: 13 ( 0.00%) trimmed reads available after processing 44224342 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 44224342 100.00% 44224355 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=36.53 fanout-score-rank=3 prefix-density=0.30 prefix-fanout=11.0 sequence=CCGCCGCCGACG criterion=fanout-score sequence-density=0.06 sequence-density-rank=4 fanout-score=63.62 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=9.1 sequence=GCCGCCGCCGCCA Started job on | Dec 07 10:52:20 Started mapping on | Dec 07 10:52:21 Finished on | Dec 07 10:56:00 Mapping speed, Million of reads per hour | 726.98 Number of input reads | 44224355 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 37633931 Uniquely mapped reads % | 85.10% Average mapped length | 49.81 Number of splices: Total | 5371131 Number of splices: Annotated (sjdb) | 5242104 Number of splices: GT/AG | 5304934 Number of splices: GC/AG | 54367 Number of splices: AT/AC | 2798 Number of splices: Non-canonical | 9032 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5113786 % of reads mapped to multiple loci | 11.56% Number of reads mapped to too many loci | 1274883 % of reads mapped to too many loci | 2.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.42% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1476638 1476638 1476638 N_multimapping 5113786 5113786 5113786 N_noFeature 614681 36716795 754033 N_ambiguous 897833 1716 121442 UnstrandedReadsAssigned:36121417 PositiveStrandReadsAssigned:915420 NegativeStrandReadsAssigned:36758456 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322434 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322434-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,224,355 reads, 40,870,841 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52973 SRR6322434.ke.tsv 35125 SRR6322434.se.tsv 88098 total ==> SRR6322434.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 111.562 4.75808 PNS24247 1044 945 0 0 PNS24249 1928 1829 254.437 4.96599 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 0.000696731 1.8128e-05 PNS24243 293 194 0 0 KQK14069 1603 1504 9572.27 227.199 KQK14071 474 375 1164.4 110.843 ==> SRR6322434.se.tsv <== BRADI_1g14170v3 10985 BRADI_1g53295v3 100 BRADI_1g59795v3 125 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 2055 BRADI_1g74790v3 150 BRADI_1g09890v3 149 BRADI_1g77505v3 474 BRADI_1g48960v3 0 SRR6322434 completed mapping pipeline successfully