Starting /dee2/code/volunteer_pipeline.sh SRR6322435 current disk space = 1543376687104 free memory = 1604859632 SRR6322435 SRAfilesize 108aca91abcd5a9ed11a1d28d26f59be SRR6322435.sra SRR6322435.sra file validated SRR6322435 is single end SRR6322435 is conventional basespace SRR6322435 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.84 32.0 32.0 32.0 27.0 32.0 2 31.175 32.0 32.0 32.0 32.0 32.0 3 34.68375 37.0 32.0 37.0 32.0 37.0 4 35.6425 37.0 37.0 37.0 32.0 37.0 5 36.6 37.0 37.0 37.0 37.0 37.0 6 40.01575 41.0 41.0 41.0 37.0 41.0 7 39.714 41.0 41.0 41.0 37.0 41.0 8 39.57275 41.0 41.0 41.0 37.0 41.0 9 39.941 41.0 41.0 41.0 37.0 41.0 10 40.46125 41.0 41.0 41.0 41.0 41.0 11 40.22375 41.0 41.0 41.0 41.0 41.0 12 40.41475 41.0 41.0 41.0 41.0 41.0 13 40.23625 41.0 41.0 41.0 41.0 41.0 14 39.54625 41.0 41.0 41.0 37.0 41.0 15 39.54775 41.0 41.0 41.0 37.0 41.0 16 39.07925 41.0 41.0 41.0 37.0 41.0 17 40.1075 41.0 41.0 41.0 37.0 41.0 18 39.97975 41.0 41.0 41.0 37.0 41.0 19 39.56325 41.0 41.0 41.0 37.0 41.0 20 39.36925 41.0 41.0 41.0 37.0 41.0 21 40.23675 41.0 41.0 41.0 41.0 41.0 22 39.80725 41.0 41.0 41.0 37.0 41.0 23 39.636 41.0 41.0 41.0 37.0 41.0 24 39.67575 41.0 41.0 41.0 37.0 41.0 25 40.121 41.0 41.0 41.0 37.0 41.0 26 39.74775 41.0 41.0 41.0 37.0 41.0 27 39.92425 41.0 41.0 41.0 37.0 41.0 28 38.67725 41.0 41.0 41.0 32.0 41.0 29 39.59125 41.0 41.0 41.0 37.0 41.0 30 39.682 41.0 41.0 41.0 37.0 41.0 31 38.40975 41.0 41.0 41.0 32.0 41.0 32 39.1315 41.0 41.0 41.0 37.0 41.0 33 38.17875 41.0 41.0 41.0 32.0 41.0 34 39.178 41.0 41.0 41.0 37.0 41.0 35 38.626 41.0 41.0 41.0 32.0 41.0 36 39.417 41.0 41.0 41.0 37.0 41.0 37 38.4805 41.0 41.0 41.0 32.0 41.0 38 38.58625 41.0 41.0 41.0 32.0 41.0 39 39.711 41.0 41.0 41.0 37.0 41.0 40 40.0735 41.0 41.0 41.0 37.0 41.0 41 35.661 41.0 37.0 41.0 12.0 41.0 42 38.4165 41.0 37.0 41.0 32.0 41.0 43 39.7605 41.0 41.0 41.0 37.0 41.0 44 38.7425 41.0 41.0 41.0 32.0 41.0 45 33.3735 41.0 27.0 41.0 12.0 41.0 46 38.746 41.0 37.0 41.0 32.0 41.0 47 37.43475 41.0 37.0 41.0 27.0 41.0 48 37.055 41.0 37.0 41.0 27.0 41.0 49 37.286 41.0 37.0 41.0 27.0 41.0 50 38.287 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 2.0 26 7.0 27 8.0 28 15.0 29 41.0 30 57.0 31 53.0 32 71.0 33 78.0 34 111.0 35 145.0 36 162.0 37 248.0 38 400.0 39 857.0 40 1741.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.41741741741742 10.035035035035035 6.431431431431431 41.11611611611611 2 22.95957284515637 12.99262649377066 33.94355453852022 30.10424612255276 3 23.175 13.675 24.125 39.025 4 26.700000000000003 20.349999999999998 20.974999999999998 31.974999999999998 5 28.825 24.725 23.225 23.225 6 25.3 28.725 23.875 22.1 7 19.475 25.775 35.4 19.35 8 19.900000000000002 25.4 29.425 25.275 9 22.125 20.974999999999998 31.924999999999997 24.975 10 22.55 32.5 25.7 19.25 11 26.724999999999998 23.5 21.975 27.800000000000004 12 22.8 21.725 25.924999999999997 29.549999999999997 13 23.25 26.25 25.3 25.2 14 23.7 23.9 26.200000000000003 26.200000000000003 15 23.599999999999998 25.95 25.275 25.174999999999997 16 23.825 23.849999999999998 24.275 28.050000000000004 17 26.1 24.2 24.725 24.975 18 22.025 24.9 27.1 25.974999999999998 19 23.225 24.8 24.224999999999998 27.750000000000004 20 22.75 25.025 27.400000000000002 24.825 21 24.8 24.65 24.575 25.974999999999998 22 23.674999999999997 25.5 23.5 27.325 23 22.8 26.325 25.324999999999996 25.55 24 23.075000000000003 23.45 24.75 28.725 25 23.474999999999998 24.275 24.675 27.575 26 24.0 24.45 25.15 26.400000000000002 27 23.775 23.849999999999998 24.0 28.375 28 24.474999999999998 24.8 23.3 27.425 29 24.9 24.175 24.5 26.424999999999997 30 23.95 23.875 26.075 26.1 31 24.5 23.1 24.349999999999998 28.050000000000004 32 24.25 24.575 24.85 26.325 33 23.325000000000003 23.825 24.099999999999998 28.749999999999996 34 24.95 24.5 23.599999999999998 26.950000000000003 35 23.799999999999997 24.825 25.874999999999996 25.5 36 23.45 23.45 26.875 26.224999999999998 37 26.6 24.224999999999998 23.075000000000003 26.1 38 23.5 24.224999999999998 25.224999999999998 27.05 39 23.549999999999997 25.624999999999996 22.975 27.85 40 23.5 25.674999999999997 23.825 27.0 41 24.4 23.200000000000003 26.3 26.1 42 24.875 23.95 23.05 28.125 43 23.225 24.8 26.25 25.724999999999998 44 23.974999999999998 24.474999999999998 24.775 26.775 45 26.125 22.675 23.849999999999998 27.35 46 25.124999999999996 24.5 25.55 24.825 47 23.925 25.525 24.75 25.8 48 23.549999999999997 24.125 25.575 26.75 49 26.125 24.474999999999998 23.575 25.825 50 22.725 23.45 25.45 28.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 0.5 24 1.0 25 3.5 26 6.0 27 9.0 28 12.0 29 18.0 30 24.0 31 28.0 32 32.0 33 49.5 34 67.0 35 92.0 36 117.0 37 137.0 38 157.0 39 178.0 40 199.0 41 246.0 42 293.0 43 297.0 44 301.0 45 304.5 46 308.0 47 317.0 48 326.0 49 359.0 50 392.0 51 327.5 52 263.0 53 253.5 54 244.0 55 220.0 56 196.0 57 182.5 58 169.0 59 149.5 60 130.0 61 134.0 62 138.0 63 128.0 64 118.0 65 115.0 66 112.0 67 104.5 68 97.0 69 88.0 70 79.0 71 72.0 72 65.0 73 57.5 74 50.0 75 48.5 76 47.0 77 40.5 78 34.0 79 23.0 80 12.0 81 9.0 82 6.0 83 3.0 84 0.0 85 1.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 1.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.97989949748744 90.725 2 3.6762761174292518 6.950000000000001 3 0.26448029621793173 0.75 4 0.026448029621793177 0.1 5 0.0 0.0 6 0.026448029621793177 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026448029621793177 1.325 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 53 1.325 TruSeq Adapter, Index 12 (100% over 50bp) CCCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.1 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498385 READS because READLEN < 1 Read 1498385 spots for SRR6322435.sra Written 1498385 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra Rejected 1498371 READS because READLEN < 1 Read 1498371 spots for SRR6322435.sra Written 1498371 spots for SRR6322435.sra SRR ids: ['SRR6322435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a5e2l2wp SRR6322435.sra spots: 29967434 blocks: [[1, 1498371], [1498372, 2996742], [2996743, 4495113], [4495114, 5993484], [5993485, 7491855], [7491856, 8990226], [8990227, 10488597], [10488598, 11986968], [11986969, 13485339], [13485340, 14983710], [14983711, 16482081], [16482082, 17980452], [17980453, 19478823], [19478824, 20977194], [20977195, 22475565], [22475566, 23973936], [23973937, 25472307], [25472308, 26970678], [26970679, 28469049], [28469050, 29967434]] SRR6322435 file size 4192470 SRR6322435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322435 SRR6322435_1.fastq Input file: SRR6322435_1.fastq trimmed: SRR6322435-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:48:06 2024 >> started Sat Dec 7 10:48:27 2024 >> done (21.363s) 29967434 reads processed; of these: 8059 ( 0.03%) short reads filtered out after trimming by size control 691276 ( 2.31%) empty reads filtered out after trimming by size control 29268099 (97.67%) reads available; of these: 3558 ( 0.01%) trimmed reads available after processing 29264541 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 62 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3496 0.01% 50 29264541 99.99% 29268099 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=6.90 fanout-score-rank=8 prefix-density=0.16 prefix-fanout=3.0 sequence=ACAACAACAACATGGCGTGTGCCTAGCTCGCAGCACTCATGCACGCAACGCATGCATGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=88.69 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.9 sequence=CGGCGGCGGCGG Started job on | Dec 07 10:48:38 Started mapping on | Dec 07 10:48:38 Finished on | Dec 07 10:49:07 Mapping speed, Million of reads per hour | 3633.28 Number of input reads | 29268099 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26587282 Uniquely mapped reads % | 90.84% Average mapped length | 49.78 Number of splices: Total | 3471141 Number of splices: Annotated (sjdb) | 3352505 Number of splices: GT/AG | 3424422 Number of splices: GC/AG | 40077 Number of splices: AT/AC | 2289 Number of splices: Non-canonical | 4353 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 882544 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 1556605 % of reads mapped to too many loci | 5.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1798273 1798273 1798273 N_multimapping 882544 882544 882544 N_noFeature 987010 25667615 1167793 N_ambiguous 772019 2081 33314 UnstrandedReadsAssigned:24828253 PositiveStrandReadsAssigned:917586 NegativeStrandReadsAssigned:25386175 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322435 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322435-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,268,099 reads, 25,221,431 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR6322435.ke.tsv 35125 SRR6322435.se.tsv 88098 total ==> SRR6322435.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 206.778 15.6051 PNS24247 1044 945 5.54449 0.370611 PNS24249 1928 1829 396.589 13.6967 PNS24246 1044 945 5.54449 0.370611 PNS24248 1044 945 5.54449 0.370611 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 1211.1 50.865 KQK14071 474 375 188.669 31.7804 ==> SRR6322435.se.tsv <== BRADI_1g14170v3 1488 BRADI_1g53295v3 169 BRADI_1g59795v3 426 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 1153 BRADI_1g74790v3 140 BRADI_1g09890v3 34 BRADI_1g77505v3 541 BRADI_1g48960v3 0 SRR6322435 completed mapping pipeline successfully