Starting /dee2/code/volunteer_pipeline.sh SRR6322436 current disk space = 1543156514816 free memory = 1604897764 SRR6322436 SRAfilesize f74ee8aab30dac54a46b1be4869f2fc6 SRR6322436.sra SRR6322436.sra file validated SRR6322436 is single end SRR6322436 is conventional basespace SRR6322436 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.875 32.0 32.0 32.0 27.0 32.0 2 31.19625 32.0 32.0 32.0 32.0 32.0 3 34.76375 37.0 32.0 37.0 32.0 37.0 4 35.805 37.0 37.0 37.0 32.0 37.0 5 36.6425 37.0 37.0 37.0 37.0 37.0 6 40.05625 41.0 41.0 41.0 37.0 41.0 7 39.68575 41.0 41.0 41.0 37.0 41.0 8 39.57275 41.0 41.0 41.0 37.0 41.0 9 39.9995 41.0 41.0 41.0 37.0 41.0 10 40.49525 41.0 41.0 41.0 41.0 41.0 11 40.17975 41.0 41.0 41.0 37.0 41.0 12 40.4015 41.0 41.0 41.0 41.0 41.0 13 40.3295 41.0 41.0 41.0 41.0 41.0 14 39.685 41.0 41.0 41.0 37.0 41.0 15 39.544 41.0 41.0 41.0 37.0 41.0 16 39.10625 41.0 41.0 41.0 37.0 41.0 17 40.17375 41.0 41.0 41.0 37.0 41.0 18 40.2175 41.0 41.0 41.0 37.0 41.0 19 39.67375 41.0 41.0 41.0 37.0 41.0 20 39.334 41.0 41.0 41.0 37.0 41.0 21 40.2425 41.0 41.0 41.0 37.0 41.0 22 39.81225 41.0 41.0 41.0 37.0 41.0 23 39.7895 41.0 41.0 41.0 37.0 41.0 24 39.72425 41.0 41.0 41.0 37.0 41.0 25 40.23225 41.0 41.0 41.0 41.0 41.0 26 39.84975 41.0 41.0 41.0 37.0 41.0 27 40.01475 41.0 41.0 41.0 37.0 41.0 28 38.7735 41.0 41.0 41.0 32.0 41.0 29 39.65575 41.0 41.0 41.0 37.0 41.0 30 39.71275 41.0 41.0 41.0 37.0 41.0 31 38.11875 41.0 41.0 41.0 32.0 41.0 32 39.143 41.0 41.0 41.0 37.0 41.0 33 38.16475 41.0 41.0 41.0 32.0 41.0 34 39.36 41.0 41.0 41.0 37.0 41.0 35 38.70375 41.0 41.0 41.0 32.0 41.0 36 39.5265 41.0 41.0 41.0 37.0 41.0 37 38.74075 41.0 41.0 41.0 32.0 41.0 38 38.629 41.0 41.0 41.0 32.0 41.0 39 39.85075 41.0 41.0 41.0 37.0 41.0 40 40.10775 41.0 41.0 41.0 37.0 41.0 41 35.869 41.0 37.0 41.0 22.0 41.0 42 38.52325 41.0 37.0 41.0 32.0 41.0 43 39.75775 41.0 41.0 41.0 37.0 41.0 44 38.809 41.0 41.0 41.0 32.0 41.0 45 33.0325 41.0 27.0 41.0 12.0 41.0 46 38.719 41.0 37.0 41.0 32.0 41.0 47 37.405 41.0 37.0 41.0 27.0 41.0 48 37.27875 41.0 37.0 41.0 27.0 41.0 49 37.34875 41.0 37.0 41.0 27.0 41.0 50 38.46625 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 5.0 27 13.0 28 27.0 29 23.0 30 39.0 31 42.0 32 76.0 33 76.0 34 108.0 35 119.0 36 216.0 37 260.0 38 398.0 39 848.0 40 1746.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.562233909341344 9.541697971450038 5.309291259704483 49.586776859504134 2 20.71156289707751 11.054637865311308 43.430749682337996 24.80304955527319 3 21.375 13.0 23.75 41.875 4 26.75 20.325 20.65 32.275 5 28.1 25.874999999999996 23.1 22.925 6 22.775000000000002 28.65 24.975 23.599999999999998 7 19.775000000000002 22.7 36.9 20.625 8 19.15 22.35 33.1 25.4 9 21.05 19.75 34.975 24.224999999999998 10 21.675 32.15 25.324999999999996 20.849999999999998 11 27.250000000000004 23.325000000000003 22.6 26.825 12 24.825 20.549999999999997 26.875 27.750000000000004 13 24.474999999999998 23.65 26.3 25.575 14 23.825 24.45 25.7 26.025 15 24.5 23.474999999999998 25.224999999999998 26.8 16 25.6 23.150000000000002 23.7 27.55 17 24.825 23.5 25.650000000000002 26.025 18 23.225 24.175 25.224999999999998 27.375 19 25.0 22.925 24.125 27.950000000000003 20 24.175 25.95 24.45 25.424999999999997 21 24.125 23.7 24.2 27.975 22 25.224999999999998 23.925 24.725 26.125 23 23.875 24.875 25.525 25.724999999999998 24 24.4 22.900000000000002 24.25 28.449999999999996 25 25.074999999999996 23.925 23.599999999999998 27.400000000000002 26 24.925 21.925 25.8 27.35 27 24.0 23.599999999999998 25.25 27.150000000000002 28 25.25 23.400000000000002 24.0 27.35 29 24.25 23.65 26.275 25.825 30 24.6 23.225 24.9 27.275 31 25.15 23.75 22.85 28.249999999999996 32 23.474999999999998 24.075 25.2 27.250000000000004 33 25.1 22.375 25.224999999999998 27.3 34 26.05 23.05 23.474999999999998 27.425 35 24.95 23.674999999999997 25.575 25.8 36 25.05 23.150000000000002 23.05 28.749999999999996 37 24.875 23.7 24.2 27.224999999999998 38 23.9 24.275 25.45 26.375 39 24.349999999999998 22.725 24.725 28.199999999999996 40 26.700000000000003 21.9 24.025 27.375 41 26.724999999999998 23.25 24.05 25.974999999999998 42 25.174999999999997 22.55 24.925 27.35 43 26.05 24.5 22.775000000000002 26.674999999999997 44 24.925 24.325 24.275 26.474999999999998 45 25.650000000000002 22.650000000000002 24.349999999999998 27.35 46 25.1 23.75 23.849999999999998 27.3 47 24.9 22.25 26.275 26.575 48 25.45 21.975 24.349999999999998 28.225 49 23.474999999999998 22.625 25.324999999999996 28.575 50 24.025 22.525000000000002 26.950000000000003 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 6.5 26 10.0 27 10.0 28 10.0 29 11.5 30 13.0 31 25.0 32 37.0 33 53.5 34 70.0 35 83.0 36 96.0 37 130.5 38 165.0 39 185.0 40 205.0 41 218.5 42 232.0 43 263.5 44 295.0 45 296.5 46 298.0 47 310.5 48 323.0 49 304.0 50 285.0 51 280.0 52 275.0 53 259.5 54 244.0 55 238.0 56 232.0 57 209.0 58 186.0 59 180.0 60 174.0 61 163.0 62 152.0 63 144.5 64 137.0 65 134.0 66 131.0 67 114.0 68 97.0 69 96.0 70 95.0 71 86.0 72 77.0 73 68.5 74 60.0 75 45.0 76 30.0 77 30.0 78 30.0 79 25.5 80 21.0 81 15.0 82 9.0 83 6.5 84 4.0 85 2.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 1.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.0450497642745 91.675 2 3.431115767417496 6.550000000000001 3 0.44525929806181247 1.275 4 0.05238344683080147 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026191723415400735 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 12 0.3 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499691 READS because READLEN < 1 Read 1499691 spots for SRR6322436.sra Written 1499691 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra Rejected 1499689 READS because READLEN < 1 Read 1499689 spots for SRR6322436.sra Written 1499689 spots for SRR6322436.sra SRR ids: ['SRR6322436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sk8k0sxj SRR6322436.sra spots: 29993782 blocks: [[1, 1499689], [1499690, 2999378], [2999379, 4499067], [4499068, 5998756], [5998757, 7498445], [7498446, 8998134], [8998135, 10497823], [10497824, 11997512], [11997513, 13497201], [13497202, 14996890], [14996891, 16496579], [16496580, 17996268], [17996269, 19495957], [19495958, 20995646], [20995647, 22495335], [22495336, 23995024], [23995025, 25494713], [25494714, 26994402], [26994403, 28494091], [28494092, 29993782]] SRR6322436 file size 4196175 SRR6322436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322436 SRR6322436_1.fastq Input file: SRR6322436_1.fastq trimmed: SRR6322436-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:25:11 2024 >> started Sat Dec 7 12:25:24 2024 >> done (12.806s) 29993782 reads processed; of these: 84 ( 0.00%) short reads filtered out after trimming by size control 122737 ( 0.41%) empty reads filtered out after trimming by size control 29870961 (99.59%) reads available; of these: 3592 ( 0.01%) trimmed reads available after processing 29867369 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3587 0.01% 50 29867369 99.99% 29870961 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=21 prefix-density=0.09 prefix-fanout=2.6 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=4 fanout-score=72.51 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=11.3 sequence=GCCGCCGCCGCCA Started job on | Dec 07 12:25:34 Started mapping on | Dec 07 12:25:34 Finished on | Dec 07 12:26:04 Mapping speed, Million of reads per hour | 3584.52 Number of input reads | 29870961 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26468972 Uniquely mapped reads % | 88.61% Average mapped length | 49.82 Number of splices: Total | 4088819 Number of splices: Annotated (sjdb) | 3969821 Number of splices: GT/AG | 4036696 Number of splices: GC/AG | 44470 Number of splices: AT/AC | 2971 Number of splices: Non-canonical | 4682 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1607865 % of reads mapped to multiple loci | 5.38% Number of reads mapped to too many loci | 1593723 % of reads mapped to too many loci | 5.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1794124 1794124 1794124 N_multimapping 1607865 1607865 1607865 N_noFeature 856652 25666473 989681 N_ambiguous 706743 1705 37989 UnstrandedReadsAssigned:24905577 PositiveStrandReadsAssigned:800794 NegativeStrandReadsAssigned:25441302 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322436 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322436-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,870,961 reads, 26,063,848 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6322436.ke.tsv 35125 SRR6322436.se.tsv 88098 total ==> SRR6322436.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 144.187 10.1275 PNS24247 1044 945 41.3918 2.57503 PNS24249 1928 1829 399.097 12.8281 PNS24246 1044 945 41.3918 2.57503 PNS24248 1044 945 41.3918 2.57503 PNS24244 1471 1372 26.54 1.13722 PNS24243 293 194 0 0 KQK14069 1603 1504 4140.6 161.851 KQK14071 474 375 799.475 125.335 ==> SRR6322436.se.tsv <== BRADI_1g14170v3 5250 BRADI_1g53295v3 159 BRADI_1g59795v3 318 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 2034 BRADI_1g74790v3 138 BRADI_1g09890v3 26 BRADI_1g77505v3 594 BRADI_1g48960v3 5 SRR6322436 completed mapping pipeline successfully