Starting /dee2/code/volunteer_pipeline.sh SRR6322437 current disk space = 1543372980224 free memory = 1598097224 SRR6322437 SRAfilesize ae5116e03e95fa4dbf4b8c0b0358c2b1 SRR6322437.sra SRR6322437.sra file validated SRR6322437 is single end SRR6322437 is conventional basespace SRR6322437 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51875 32.0 32.0 32.0 32.0 32.0 2 29.9125 32.0 32.0 32.0 27.0 32.0 3 35.26375 37.0 32.0 37.0 32.0 37.0 4 34.39625 37.0 37.0 37.0 27.0 37.0 5 35.75 37.0 37.0 37.0 32.0 37.0 6 40.04125 41.0 41.0 41.0 37.0 41.0 7 40.339 41.0 41.0 41.0 37.0 41.0 8 40.3765 41.0 41.0 41.0 41.0 41.0 9 39.9615 41.0 41.0 41.0 37.0 41.0 10 40.1815 41.0 41.0 41.0 37.0 41.0 11 38.44475 41.0 41.0 41.0 32.0 41.0 12 39.812 41.0 41.0 41.0 37.0 41.0 13 40.23375 41.0 41.0 41.0 37.0 41.0 14 40.29525 41.0 41.0 41.0 41.0 41.0 15 39.3665 41.0 41.0 41.0 37.0 41.0 16 39.34625 41.0 41.0 41.0 37.0 41.0 17 40.238 41.0 41.0 41.0 37.0 41.0 18 40.31775 41.0 41.0 41.0 37.0 41.0 19 40.2195 41.0 41.0 41.0 41.0 41.0 20 39.833 41.0 41.0 41.0 37.0 41.0 21 37.6285 41.0 37.0 41.0 27.0 41.0 22 39.675 41.0 41.0 41.0 37.0 41.0 23 37.5545 41.0 37.0 41.0 27.0 41.0 24 39.37925 41.0 41.0 41.0 37.0 41.0 25 39.602 41.0 41.0 41.0 37.0 41.0 26 38.018 41.0 37.0 41.0 32.0 41.0 27 33.12125 37.0 27.0 41.0 12.0 41.0 28 35.02875 41.0 32.0 41.0 22.0 41.0 29 38.82075 41.0 37.0 41.0 32.0 41.0 30 39.1565 41.0 41.0 41.0 37.0 41.0 31 38.71475 41.0 41.0 41.0 32.0 41.0 32 38.351 41.0 41.0 41.0 32.0 41.0 33 31.802 37.0 22.0 41.0 12.0 41.0 34 37.192 41.0 37.0 41.0 27.0 41.0 35 38.744 41.0 41.0 41.0 32.0 41.0 36 39.683 41.0 41.0 41.0 37.0 41.0 37 39.67225 41.0 41.0 41.0 37.0 41.0 38 38.1525 41.0 41.0 41.0 32.0 41.0 39 38.2415 41.0 41.0 41.0 32.0 41.0 40 38.82225 41.0 41.0 41.0 32.0 41.0 41 39.2205 41.0 41.0 41.0 37.0 41.0 42 39.5645 41.0 41.0 41.0 37.0 41.0 43 39.68175 41.0 41.0 41.0 37.0 41.0 44 38.705 41.0 41.0 41.0 32.0 41.0 45 38.6665 41.0 41.0 41.0 32.0 41.0 46 31.69325 37.0 22.0 41.0 12.0 41.0 47 36.58925 41.0 37.0 41.0 27.0 41.0 48 37.43575 41.0 37.0 41.0 27.0 41.0 49 39.3105 41.0 41.0 41.0 37.0 41.0 50 39.61375 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 3.0 24 1.0 25 1.0 26 6.0 27 18.0 28 24.0 29 27.0 30 42.0 31 52.0 32 89.0 33 109.0 34 149.0 35 193.0 36 237.0 37 383.0 38 567.0 39 1057.0 40 1040.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.484871217804454 11.70292573143286 5.826456614153538 42.98574643660915 2 22.230991844251513 10.60247303341226 41.46277295448566 25.703762167850563 3 19.85 14.85 26.05 39.25 4 25.3 21.475 24.224999999999998 28.999999999999996 5 26.375 26.174999999999997 25.8 21.65 6 21.925 30.975 25.224999999999998 21.875 7 18.6 23.724999999999998 39.675 18.0 8 18.475 21.9 34.225 25.4 9 18.85 19.55 37.175000000000004 24.425 10 22.225 31.45 27.375 18.95 11 25.674999999999997 22.650000000000002 24.275 27.400000000000002 12 22.975 23.05 27.025 26.950000000000003 13 22.400000000000002 25.55 26.575 25.474999999999998 14 22.15 24.175 28.549999999999997 25.124999999999996 15 23.0 24.7 25.775 26.525 16 24.25 23.425 26.400000000000002 25.924999999999997 17 23.775 24.975 27.1 24.15 18 23.05 25.474999999999998 25.8 25.674999999999997 19 24.099999999999998 25.8 25.674999999999997 24.425 20 25.25 24.125 25.924999999999997 24.7 21 24.075 23.0 25.575 27.35 22 23.400000000000002 25.75 25.525 25.324999999999996 23 23.925 24.875 26.875 24.325 24 23.724999999999998 24.425 25.525 26.325 25 23.599999999999998 24.25 25.2 26.950000000000003 26 24.125 26.200000000000003 25.974999999999998 23.7 27 26.150000000000002 23.799999999999997 25.224999999999998 24.825 28 23.525 25.45 25.525 25.5 29 24.15 24.025 26.700000000000003 25.124999999999996 30 22.3 24.2 25.825 27.675 31 23.35 25.25 26.075 25.324999999999996 32 23.025000000000002 24.15 27.35 25.474999999999998 33 26.5 22.400000000000002 26.025 25.074999999999996 34 24.05 24.65 24.975 26.325 35 23.325000000000003 25.575 25.224999999999998 25.874999999999996 36 21.325 24.7 26.775 27.200000000000003 37 23.775 24.2 25.674999999999997 26.35 38 23.7 24.025 26.325 25.95 39 22.95 23.75 26.650000000000002 26.650000000000002 40 22.650000000000002 25.924999999999997 24.7 26.724999999999998 41 23.325000000000003 25.974999999999998 27.1 23.599999999999998 42 24.85 23.5 25.55 26.1 43 23.25 25.275 24.15 27.325 44 21.725 26.150000000000002 26.525 25.6 45 22.7 25.75 25.374999999999996 26.174999999999997 46 26.724999999999998 24.75 23.825 24.7 47 23.875 24.099999999999998 27.525 24.5 48 24.825 23.625 25.95 25.6 49 24.349999999999998 25.5 24.525 25.624999999999996 50 25.525 25.525 24.7 24.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.5 22 4.0 23 3.5 24 3.0 25 5.5 26 8.0 27 12.5 28 17.0 29 19.5 30 22.0 31 36.5 32 51.0 33 71.0 34 91.0 35 109.0 36 127.0 37 166.0 38 205.0 39 217.0 40 229.0 41 263.0 42 297.0 43 336.5 44 376.0 45 370.5 46 365.0 47 351.0 48 337.0 49 333.0 50 329.0 51 299.0 52 269.0 53 265.0 54 261.0 55 212.0 56 163.0 57 162.5 58 162.0 59 149.0 60 136.0 61 118.5 62 101.0 63 89.0 64 77.0 65 78.5 66 80.0 67 86.0 68 92.0 69 75.0 70 58.0 71 52.0 72 46.0 73 41.0 74 36.0 75 30.5 76 25.0 77 19.0 78 13.0 79 12.0 80 11.0 81 8.0 82 5.0 83 3.5 84 2.0 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 4.9750000000000005 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.28575190940217 90.45 2 4.213853041875164 8.0 3 0.3687121411640769 1.05 4 0.13168290755859888 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533525 READS because READLEN < 1 Read 1533525 spots for SRR6322437.sra Written 1533525 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra Rejected 1533520 READS because READLEN < 1 Read 1533520 spots for SRR6322437.sra Written 1533520 spots for SRR6322437.sra SRR ids: ['SRR6322437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1sbecxdv SRR6322437.sra spots: 30670405 blocks: [[1, 1533520], [1533521, 3067040], [3067041, 4600560], [4600561, 6134080], [6134081, 7667600], [7667601, 9201120], [9201121, 10734640], [10734641, 12268160], [12268161, 13801680], [13801681, 15335200], [15335201, 16868720], [16868721, 18402240], [18402241, 19935760], [19935761, 21469280], [21469281, 23002800], [23002801, 24536320], [24536321, 26069840], [26069841, 27603360], [27603361, 29136880], [29136881, 30670405]] SRR6322437 file size 4291325 SRR6322437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322437 SRR6322437_1.fastq Input file: SRR6322437_1.fastq trimmed: SRR6322437-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:48:51 2024 >> started Sat Dec 7 10:49:18 2024 >> done (27.167s) 30670405 reads processed; of these: 46 ( 0.00%) short reads filtered out after trimming by size control 14783 ( 0.05%) empty reads filtered out after trimming by size control 30655576 (99.95%) reads available; of these: 17 ( 0.00%) trimmed reads available after processing 30655559 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 11 0.00% 50 30655559 100.00% 30655576 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=28 prefix-density=0.48 prefix-fanout=2.0 sequence=TTTGGCTTTGGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=41.90 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=4.4 sequence=GCTGCTGCTGCATGATGGCCTGTGCCACGCCGTTGACAGCCTGGCACCGGAACTGCTCTGGGATCTGGGCCAGCTGCTGGCA Started job on | Dec 07 10:49:32 Started mapping on | Dec 07 10:49:33 Finished on | Dec 07 10:50:06 Mapping speed, Million of reads per hour | 3344.24 Number of input reads | 30655576 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26870154 Uniquely mapped reads % | 87.65% Average mapped length | 49.81 Number of splices: Total | 4139732 Number of splices: Annotated (sjdb) | 3979161 Number of splices: GT/AG | 4062231 Number of splices: GC/AG | 50558 Number of splices: AT/AC | 3321 Number of splices: Non-canonical | 23622 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3337158 % of reads mapped to multiple loci | 10.89% Number of reads mapped to too many loci | 281486 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448264 448264 448264 N_multimapping 3337158 3337158 3337158 N_noFeature 1411750 26413756 1565666 N_ambiguous 341839 1744 39346 UnstrandedReadsAssigned:25116565 PositiveStrandReadsAssigned:454654 NegativeStrandReadsAssigned:25265142 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322437 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322437-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,655,576 reads, 27,086,315 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,274 rounds 52973 SRR6322437.ke.tsv 35125 SRR6322437.se.tsv 88098 total ==> SRR6322437.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 172.63 12.0907 PNS24247 1044 945 60.32 3.74189 PNS24249 1928 1829 484.302 15.5226 PNS24246 1044 945 60.32 3.74189 PNS24248 1044 945 60.32 3.74189 PNS24244 1471 1372 99.1081 4.23465 PNS24243 293 194 0 0 KQK14069 1603 1504 489.453 19.0777 KQK14071 474 375 99.2696 15.5184 ==> SRR6322437.se.tsv <== BRADI_1g14170v3 619 BRADI_1g53295v3 333 BRADI_1g59795v3 337 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 2039 BRADI_1g74790v3 21 BRADI_1g09890v3 7 BRADI_1g77505v3 794 BRADI_1g48960v3 2 SRR6322437 completed mapping pipeline successfully