Starting /dee2/code/volunteer_pipeline.sh SRR6322438 current disk space = 1543330820096 free memory = 1600368004 SRR6322438 SRAfilesize 60e419d0b74e77f138d0ea0b84ddef2c SRR6322438.sra SRR6322438.sra file validated SRR6322438 is single end SRR6322438 is conventional basespace SRR6322438 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.43625 32.0 32.0 32.0 32.0 32.0 2 29.775 32.0 32.0 32.0 27.0 32.0 3 35.21375 37.0 32.0 37.0 32.0 37.0 4 34.135 37.0 32.0 37.0 27.0 37.0 5 35.60375 37.0 37.0 37.0 32.0 37.0 6 39.98575 41.0 41.0 41.0 37.0 41.0 7 40.2725 41.0 41.0 41.0 37.0 41.0 8 40.317 41.0 41.0 41.0 41.0 41.0 9 39.944 41.0 41.0 41.0 37.0 41.0 10 40.19875 41.0 41.0 41.0 37.0 41.0 11 38.55925 41.0 41.0 41.0 32.0 41.0 12 39.77475 41.0 41.0 41.0 37.0 41.0 13 40.1715 41.0 41.0 41.0 37.0 41.0 14 40.39525 41.0 41.0 41.0 41.0 41.0 15 39.18625 41.0 41.0 41.0 37.0 41.0 16 39.41075 41.0 41.0 41.0 37.0 41.0 17 40.25475 41.0 41.0 41.0 37.0 41.0 18 40.30475 41.0 41.0 41.0 41.0 41.0 19 40.179 41.0 41.0 41.0 37.0 41.0 20 39.738 41.0 41.0 41.0 37.0 41.0 21 37.5325 41.0 37.0 41.0 27.0 41.0 22 39.64575 41.0 41.0 41.0 37.0 41.0 23 37.546 41.0 37.0 41.0 27.0 41.0 24 39.39575 41.0 41.0 41.0 37.0 41.0 25 39.53075 41.0 41.0 41.0 37.0 41.0 26 37.7785 41.0 37.0 41.0 27.0 41.0 27 32.749 37.0 27.0 41.0 12.0 41.0 28 34.66025 41.0 32.0 41.0 22.0 41.0 29 38.7385 41.0 37.0 41.0 32.0 41.0 30 39.104 41.0 41.0 41.0 37.0 41.0 31 38.6415 41.0 41.0 41.0 32.0 41.0 32 38.25525 41.0 37.0 41.0 32.0 41.0 33 31.7025 37.0 22.0 41.0 12.0 41.0 34 37.07775 41.0 37.0 41.0 27.0 41.0 35 38.701 41.0 37.0 41.0 32.0 41.0 36 39.64325 41.0 41.0 41.0 37.0 41.0 37 39.5875 41.0 41.0 41.0 37.0 41.0 38 38.243 41.0 41.0 41.0 32.0 41.0 39 38.159 41.0 41.0 41.0 32.0 41.0 40 38.5605 41.0 41.0 41.0 32.0 41.0 41 39.20775 41.0 41.0 41.0 37.0 41.0 42 39.29 41.0 41.0 41.0 37.0 41.0 43 39.5195 41.0 41.0 41.0 37.0 41.0 44 38.4925 41.0 41.0 41.0 32.0 41.0 45 38.62 41.0 41.0 41.0 32.0 41.0 46 31.43225 37.0 22.0 41.0 12.0 41.0 47 36.2855 41.0 37.0 41.0 22.0 41.0 48 37.23775 41.0 37.0 41.0 27.0 41.0 49 39.338 41.0 41.0 41.0 37.0 41.0 50 39.543 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 6.0 26 9.0 27 24.0 28 25.0 29 43.0 30 50.0 31 59.0 32 87.0 33 98.0 34 156.0 35 177.0 36 260.0 37 356.0 38 605.0 39 1008.0 40 1035.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.26131532883221 10.702675668917228 7.726931732933233 36.30907726931733 2 25.681036762761174 10.446971700608303 36.65696905580534 27.21502248082518 3 22.375 15.8 26.700000000000003 35.125 4 26.55 18.925 26.150000000000002 28.375 5 28.875 24.575 25.4 21.15 6 24.725 27.725 24.625 22.925 7 19.275000000000002 24.125 40.575 16.025 8 21.675 21.875 31.3 25.15 9 21.15 18.325 36.525 24.0 10 24.325 29.225 27.3 19.15 11 27.375 21.075 25.5 26.05 12 25.474999999999998 20.849999999999998 27.3 26.375 13 26.25 23.549999999999997 25.575 24.625 14 23.724999999999998 23.075000000000003 25.074999999999996 28.125 15 23.125 23.549999999999997 27.224999999999998 26.1 16 26.1 21.2 27.025 25.674999999999997 17 25.775 21.8 26.55 25.874999999999996 18 25.424999999999997 24.175 26.325 24.075 19 25.650000000000002 23.075000000000003 25.0 26.275 20 25.775 21.95 27.625 24.65 21 27.075 22.325 24.9 25.7 22 24.975 23.150000000000002 25.45 26.424999999999997 23 25.174999999999997 24.099999999999998 25.85 24.875 24 25.525 22.95 26.424999999999997 25.1 25 25.374999999999996 22.05 26.825 25.75 26 25.25 23.65 25.974999999999998 25.124999999999996 27 27.725 23.425 24.375 24.474999999999998 28 24.9 23.05 25.374999999999996 26.674999999999997 29 24.85 23.400000000000002 27.325 24.425 30 23.525 24.125 26.75 25.6 31 25.724999999999998 23.65 24.125 26.5 32 24.65 22.075 28.575 24.7 33 25.974999999999998 21.7 25.7 26.625 34 24.95 21.7 25.7 27.650000000000002 35 24.575 23.674999999999997 25.874999999999996 25.874999999999996 36 24.15 22.175 27.425 26.25 37 25.25 22.925 26.775 25.05 38 24.15 23.9 25.874999999999996 26.075 39 25.7 21.775 27.875 24.65 40 24.3 24.224999999999998 25.7 25.775 41 23.25 23.125 25.8 27.825 42 23.775 24.125 26.450000000000003 25.650000000000002 43 24.55 21.375 26.224999999999998 27.85 44 24.95 23.075000000000003 26.724999999999998 25.25 45 24.95 22.225 26.575 26.25 46 28.225 21.525 24.8 25.45 47 25.05 22.875 26.450000000000003 25.624999999999996 48 26.025 21.9 26.525 25.55 49 26.700000000000003 22.475 25.55 25.275 50 24.625 23.1 26.400000000000002 25.874999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 1.5 24 1.0 25 6.0 26 11.0 27 13.5 28 16.0 29 16.5 30 17.0 31 25.5 32 34.0 33 46.5 34 59.0 35 83.0 36 107.0 37 134.0 38 161.0 39 173.0 40 185.0 41 224.0 42 263.0 43 289.5 44 316.0 45 345.0 46 374.0 47 340.5 48 307.0 49 307.0 50 307.0 51 294.0 52 281.0 53 278.0 54 275.0 55 240.0 56 205.0 57 200.0 58 195.0 59 183.5 60 172.0 61 167.0 62 162.0 63 141.5 64 121.0 65 111.5 66 102.0 67 95.0 68 88.0 69 88.5 70 89.0 71 66.5 72 44.0 73 43.5 74 43.0 75 35.0 76 27.0 77 23.0 78 19.0 79 14.5 80 10.0 81 5.5 82 1.0 83 1.5 84 2.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 5.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.84967320261438 79.925 2 6.848536516055698 12.049999999999999 3 1.3071895424836601 3.45 4 0.7104290991759022 2.5 5 0.11366865586814436 0.5 6 0.05683432793407218 0.3 7 0.02841716396703609 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.08525149190110827 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTAT 21 0.525 TruSeq Adapter, Index 25 (97% over 44bp) GTATGATTAACAGCTGCCCTCGACGAAGAAGTCCATTGAACACATTGCGG 13 0.325 No Hit GTTATTTTTAAGGTTTTGAGCTTCTTGCCTAGAGATGCGGTACGCATTGG 10 0.25 No Hit CGGGAAATTCTGACCGTTGAGGCGTGCGATACTGCCAGCACGTGGGTTGT 7 0.17500000000000002 No Hit GTGATGTTTGTTCATTGATACCAAAGGCCTGGCTAAGCAACTGGGCATTT 6 0.15 No Hit GTCTTTATTTCACCCTAATAGTTATCATACTAACTCATTCACTCCTGTGC 6 0.15 No Hit CACCCTAATAGTTATCATACTAACTCATTCACTCCTGTGCCTTAGGGGTC 5 0.125 No Hit CCTTGGATCACGTACACCACGCTATGGGCATTAATGTTCCAGAATGGTGA 5 0.125 No Hit GGGAAATTCTGACCGTTGAGGCGTGCGATACTGCCAGCACGTGGGTTGTA 5 0.125 No Hit CTTGAAAGCGATATACTGGTATCCTTCACTCTCCGCCTTCTTTAAAACGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671929 READS because READLEN < 1 Read 1671929 spots for SRR6322438.sra Written 1671929 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra Rejected 1671922 READS because READLEN < 1 Read 1671922 spots for SRR6322438.sra Written 1671922 spots for SRR6322438.sra SRR ids: ['SRR6322438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_50ql1w9r SRR6322438.sra spots: 33438447 blocks: [[1, 1671922], [1671923, 3343844], [3343845, 5015766], [5015767, 6687688], [6687689, 8359610], [8359611, 10031532], [10031533, 11703454], [11703455, 13375376], [13375377, 15047298], [15047299, 16719220], [16719221, 18391142], [18391143, 20063064], [20063065, 21734986], [21734987, 23406908], [23406909, 25078830], [25078831, 26750752], [26750753, 28422674], [28422675, 30094596], [30094597, 31766518], [31766519, 33438447]] SRR6322438 file size 4680581 SRR6322438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322438 SRR6322438_1.fastq Input file: SRR6322438_1.fastq trimmed: SRR6322438-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:50:10 2024 >> started Sat Dec 7 10:50:39 2024 >> done (28.833s) 33438447 reads processed; of these: 150 ( 0.00%) short reads filtered out after trimming by size control 220580 ( 0.66%) empty reads filtered out after trimming by size control 33217717 (99.34%) reads available; of these: 37 ( 0.00%) trimmed reads available after processing 33217680 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 8 0.00% 50 33217680 100.00% 33217717 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=27 prefix-density=1.28 prefix-fanout=1.9 sequence=TTTGGCTTTGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=51.74 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.0 sequence=TTTATTTATATTTTATTGAGAACACAAACATCAAGTGCTGCACACTTGCGATTTATTTATTTTACTCTACAGTTCTCATATATATTAGTTCATTCGCTCTGATGCCTTGCGACTTGAAGCCGATTCCTCAAAACTCTGGTAGCTCAATGGAGGGAATTTAGTAGTGAAGGCGCCAAACTCTTCTCCCC Started job on | Dec 07 10:50:49 Started mapping on | Dec 07 10:50:49 Finished on | Dec 07 10:51:17 Mapping speed, Million of reads per hour | 4270.85 Number of input reads | 33217717 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 25503917 Uniquely mapped reads % | 76.78% Average mapped length | 49.79 Number of splices: Total | 2795201 Number of splices: Annotated (sjdb) | 2650424 Number of splices: GT/AG | 2709500 Number of splices: GC/AG | 35793 Number of splices: AT/AC | 1463 Number of splices: Non-canonical | 48445 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 7255149 % of reads mapped to multiple loci | 21.84% Number of reads mapped to too many loci | 268920 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 458651 458651 458651 N_multimapping 7255149 7255149 7255149 N_noFeature 1067916 25084506 1189992 N_ambiguous 351284 987 54535 UnstrandedReadsAssigned:24084717 PositiveStrandReadsAssigned:418424 NegativeStrandReadsAssigned:24259390 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322438 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322438-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,217,717 reads, 29,380,743 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR6322438.ke.tsv 35125 SRR6322438.se.tsv 88098 total ==> SRR6322438.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 31.2574 1.73799 PNS24247 1044 945 72.1592 3.5537 PNS24249 1928 1829 437.747 11.1386 PNS24246 1044 945 72.1592 3.5537 PNS24248 1044 945 72.1592 3.5537 PNS24244 1471 1372 76.5175 2.59554 PNS24243 293 194 0 0 KQK14069 1603 1504 2539.14 78.5706 KQK14071 474 375 680.847 84.4967 ==> SRR6322438.se.tsv <== BRADI_1g14170v3 3825 BRADI_1g53295v3 577 BRADI_1g59795v3 221 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 385 BRADI_1g74790v3 3 BRADI_1g09890v3 0 BRADI_1g77505v3 331 BRADI_1g48960v3 2 SRR6322438 completed mapping pipeline successfully