Starting /dee2/code/volunteer_pipeline.sh SRR6322439 current disk space = 1543346290688 free memory = 1415677608 SRR6322439 SRAfilesize a50f5482117d6be2f42612ab67a3cabd SRR6322439.sra SRR6322439.sra file validated SRR6322439 is single end SRR6322439 is conventional basespace SRR6322439 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4175 32.0 32.0 32.0 32.0 32.0 2 30.43125 32.0 32.0 32.0 32.0 32.0 3 32.14 32.0 32.0 37.0 27.0 37.0 4 36.0325 37.0 37.0 37.0 32.0 37.0 5 35.995 37.0 37.0 37.0 32.0 37.0 6 40.13675 41.0 41.0 41.0 37.0 41.0 7 37.7455 41.0 37.0 41.0 32.0 41.0 8 40.07175 41.0 41.0 41.0 37.0 41.0 9 38.05925 41.0 37.0 41.0 32.0 41.0 10 40.4 41.0 41.0 41.0 37.0 41.0 11 40.5825 41.0 41.0 41.0 41.0 41.0 12 40.3385 41.0 41.0 41.0 41.0 41.0 13 39.61275 41.0 41.0 41.0 37.0 41.0 14 37.7585 41.0 37.0 41.0 32.0 41.0 15 39.5315 41.0 41.0 41.0 37.0 41.0 16 39.4145 41.0 41.0 41.0 37.0 41.0 17 40.2955 41.0 41.0 41.0 37.0 41.0 18 39.708 41.0 41.0 41.0 37.0 41.0 19 40.368 41.0 41.0 41.0 41.0 41.0 20 40.16425 41.0 41.0 41.0 37.0 41.0 21 40.21625 41.0 41.0 41.0 37.0 41.0 22 40.50675 41.0 41.0 41.0 41.0 41.0 23 39.768 41.0 41.0 41.0 37.0 41.0 24 36.701 41.0 37.0 41.0 27.0 41.0 25 36.94525 41.0 37.0 41.0 27.0 41.0 26 36.97825 41.0 37.0 41.0 27.0 41.0 27 39.34175 41.0 41.0 41.0 37.0 41.0 28 37.2765 41.0 37.0 41.0 27.0 41.0 29 37.36575 41.0 37.0 41.0 27.0 41.0 30 38.1015 41.0 37.0 41.0 32.0 41.0 31 33.099 37.0 27.0 41.0 12.0 41.0 32 33.44675 37.0 27.0 41.0 12.0 41.0 33 34.54875 37.0 32.0 41.0 22.0 41.0 34 29.54075 32.0 22.0 41.0 12.0 41.0 35 37.78225 41.0 37.0 41.0 32.0 41.0 36 38.8955 41.0 37.0 41.0 37.0 41.0 37 32.879 37.0 27.0 41.0 12.0 41.0 38 38.18475 41.0 37.0 41.0 32.0 41.0 39 39.6565 41.0 41.0 41.0 37.0 41.0 40 39.22 41.0 41.0 41.0 37.0 41.0 41 39.0935 41.0 41.0 41.0 37.0 41.0 42 39.78 41.0 41.0 41.0 37.0 41.0 43 39.10375 41.0 41.0 41.0 37.0 41.0 44 39.95025 41.0 41.0 41.0 37.0 41.0 45 39.50975 41.0 41.0 41.0 37.0 41.0 46 38.7335 41.0 41.0 41.0 32.0 41.0 47 37.219 41.0 37.0 41.0 27.0 41.0 48 39.428 41.0 41.0 41.0 37.0 41.0 49 39.603 41.0 41.0 41.0 37.0 41.0 50 37.95225 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 6.0 27 14.0 28 13.0 29 23.0 30 34.0 31 54.0 32 73.0 33 103.0 34 138.0 35 233.0 36 352.0 37 511.0 38 863.0 39 1095.0 40 484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.747373686843424 12.38119059529765 6.728364182091045 36.14307153576789 2 26.930028401755745 10.689388071262588 31.78414665633876 30.59643687064291 3 23.799999999999997 14.475 22.275 39.45 4 29.025000000000002 19.525000000000002 19.825 31.624999999999996 5 28.825 21.8 22.75 26.625 6 27.975 26.25 22.25 23.525 7 21.575 23.075000000000003 34.2 21.15 8 22.0 22.95 28.425 26.625 9 21.15 20.65 31.974999999999998 26.224999999999998 10 24.05 32.15 23.225 20.575 11 25.474999999999998 23.125 22.2 29.2 12 25.474999999999998 20.4 26.05 28.075 13 26.25 22.0 25.6 26.150000000000002 14 25.424999999999997 23.775 23.200000000000003 27.6 15 25.1 23.075000000000003 24.925 26.900000000000002 16 26.775 22.75 22.925 27.55 17 25.1 23.575 24.349999999999998 26.974999999999998 18 24.725 22.525000000000002 24.025 28.725 19 25.324999999999996 22.725 24.5 27.450000000000003 20 25.35 24.625 24.375 25.650000000000002 21 25.624999999999996 22.8 24.45 27.125 22 26.875 23.724999999999998 23.0 26.400000000000002 23 26.150000000000002 23.175 23.875 26.8 24 25.35 22.35 24.775 27.525 25 24.525 23.875 22.825 28.775000000000002 26 26.400000000000002 22.95 23.849999999999998 26.8 27 25.775 23.625 23.775 26.825 28 27.224999999999998 24.099999999999998 21.6 27.075 29 26.625 22.275 23.849999999999998 27.250000000000004 30 26.325 21.95 23.625 28.1 31 27.700000000000003 22.675 23.0 26.625 32 26.5 22.15 22.75 28.599999999999998 33 23.95 23.25 23.9 28.9 34 26.875 22.5 24.0 26.625 35 27.275 23.575 21.975 27.175 36 25.324999999999996 23.549999999999997 23.474999999999998 27.650000000000002 37 26.700000000000003 22.75 22.2 28.349999999999998 38 24.85 23.275000000000002 23.275000000000002 28.599999999999998 39 25.15 22.45 24.45 27.950000000000003 40 27.6 23.35 21.825 27.224999999999998 41 26.974999999999998 22.45 22.925 27.650000000000002 42 25.45 23.05 22.5 28.999999999999996 43 26.825 22.475 23.325000000000003 27.375 44 26.85 22.900000000000002 22.45 27.800000000000004 45 24.7 22.175 24.349999999999998 28.775000000000002 46 27.150000000000002 23.849999999999998 21.175 27.825 47 26.05 23.225 22.650000000000002 28.075 48 24.7 23.974999999999998 25.174999999999997 26.150000000000002 49 27.900000000000002 22.2 22.3 27.6 50 26.8 23.75 22.05 27.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 5.5 26 8.0 27 6.0 28 4.0 29 13.5 30 23.0 31 29.0 32 35.0 33 46.0 34 57.0 35 70.0 36 83.0 37 118.5 38 154.0 39 156.5 40 159.0 41 184.5 42 210.0 43 222.0 44 234.0 45 251.5 46 269.0 47 264.5 48 260.0 49 269.5 50 279.0 51 266.0 52 253.0 53 231.0 54 209.0 55 209.5 56 210.0 57 195.5 58 181.0 59 186.0 60 191.0 61 193.5 62 196.0 63 189.5 64 183.0 65 188.0 66 193.0 67 172.5 68 152.0 69 142.5 70 133.0 71 115.5 72 98.0 73 97.0 74 96.0 75 76.5 76 57.0 77 46.0 78 35.0 79 27.5 80 20.0 81 12.5 82 5.0 83 4.5 84 4.0 85 3.5 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 3.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.73074908328968 91.375 2 3.8501833420639078 7.35 3 0.34049240440020956 0.975 4 0.0785751702462022 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Written 2713296 spots for SRR6322439.sra Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra Rejected 2713296 READS because READLEN < 1 Read 2713296 spots for SRR6322439.sra Written 2713296 spots for SRR6322439.sra SRR ids: ['SRR6322439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tp9n5iis SRR6322439.sra spots: 54265920 blocks: [[1, 2713296], [2713297, 5426592], [5426593, 8139888], [8139889, 10853184], [10853185, 13566480], [13566481, 16279776], [16279777, 18993072], [18993073, 21706368], [21706369, 24419664], [24419665, 27132960], [27132961, 29846256], [29846257, 32559552], [32559553, 35272848], [35272849, 37986144], [37986145, 40699440], [40699441, 43412736], [43412737, 46126032], [46126033, 48839328], [48839329, 51552624], [51552625, 54265920]] SRR6322439 file size 7609444 SRR6322439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322439 SRR6322439_1.fastq Input file: SRR6322439_1.fastq trimmed: SRR6322439-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:54:41 2024 >> started Sat Dec 7 10:55:08 2024 >> done (27.107s) 54265920 reads processed; of these: 129 ( 0.00%) short reads filtered out after trimming by size control 63500 ( 0.12%) empty reads filtered out after trimming by size control 54202291 (99.88%) reads available; of these: 15 ( 0.00%) trimmed reads available after processing 54202276 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 54202276 100.00% 54202291 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=61.11 fanout-score-rank=5 prefix-density=0.40 prefix-fanout=13.8 sequence=CCGCCGCCGACG criterion=fanout-score sequence-density=0.06 sequence-density-rank=6 fanout-score=114.11 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=14.8 sequence=GCGGCGGCGGCG Started job on | Dec 07 10:55:26 Started mapping on | Dec 07 10:55:26 Finished on | Dec 07 10:56:05 Mapping speed, Million of reads per hour | 5003.29 Number of input reads | 54202291 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 47866735 Uniquely mapped reads % | 88.31% Average mapped length | 49.78 Number of splices: Total | 6558803 Number of splices: Annotated (sjdb) | 6397086 Number of splices: GT/AG | 6475926 Number of splices: GC/AG | 70168 Number of splices: AT/AC | 3342 Number of splices: Non-canonical | 9367 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4608145 % of reads mapped to multiple loci | 8.50% Number of reads mapped to too many loci | 1474561 % of reads mapped to too many loci | 2.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1727411 1727411 1727411 N_multimapping 4608145 4608145 4608145 N_noFeature 818901 46777900 1028778 N_ambiguous 994964 2242 116740 UnstrandedReadsAssigned:46052870 PositiveStrandReadsAssigned:1086593 NegativeStrandReadsAssigned:46721217 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322439 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322439-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,202,291 reads, 50,020,915 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,240 rounds 52973 SRR6322439.ke.tsv 35125 SRR6322439.se.tsv 88098 total ==> SRR6322439.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 58.3479 1.74349 PNS24249 1928 1829 508.956 7.85764 PNS24246 1044 945 58.3479 1.74349 PNS24248 1044 945 58.3479 1.74349 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 10171.3 190.964 KQK14071 474 375 1861.17 140.146 ==> SRR6322439.se.tsv <== BRADI_1g14170v3 12262 BRADI_1g53295v3 101 BRADI_1g59795v3 134 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 2081 BRADI_1g74790v3 391 BRADI_1g09890v3 249 BRADI_1g77505v3 646 BRADI_1g48960v3 0 SRR6322439 completed mapping pipeline successfully