Starting /dee2/code/volunteer_pipeline.sh SRR6322440 current disk space = 1543375712256 free memory = 1598454668 SRR6322440 SRAfilesize b75fa027a55a5a609dfcedc2f899199a SRR6322440.sra SRR6322440.sra file validated SRR6322440 is single end SRR6322440 is conventional basespace SRR6322440 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51875 32.0 32.0 32.0 32.0 32.0 2 30.26 32.0 32.0 32.0 32.0 32.0 3 35.4125 37.0 32.0 37.0 32.0 37.0 4 34.78375 37.0 37.0 37.0 32.0 37.0 5 35.73 37.0 37.0 37.0 32.0 37.0 6 40.11025 41.0 41.0 41.0 37.0 41.0 7 40.30275 41.0 41.0 41.0 37.0 41.0 8 40.424 41.0 41.0 41.0 41.0 41.0 9 40.1195 41.0 41.0 41.0 37.0 41.0 10 40.28825 41.0 41.0 41.0 41.0 41.0 11 39.0235 41.0 41.0 41.0 37.0 41.0 12 39.936 41.0 41.0 41.0 37.0 41.0 13 40.19325 41.0 41.0 41.0 37.0 41.0 14 40.3965 41.0 41.0 41.0 41.0 41.0 15 39.522 41.0 41.0 41.0 37.0 41.0 16 39.4175 41.0 41.0 41.0 37.0 41.0 17 40.316 41.0 41.0 41.0 41.0 41.0 18 40.2665 41.0 41.0 41.0 37.0 41.0 19 40.25525 41.0 41.0 41.0 41.0 41.0 20 39.87775 41.0 41.0 41.0 37.0 41.0 21 38.01725 41.0 37.0 41.0 27.0 41.0 22 39.744 41.0 41.0 41.0 37.0 41.0 23 37.90025 41.0 37.0 41.0 27.0 41.0 24 39.646 41.0 41.0 41.0 37.0 41.0 25 39.6485 41.0 41.0 41.0 37.0 41.0 26 38.1895 41.0 41.0 41.0 32.0 41.0 27 33.70175 41.0 27.0 41.0 12.0 41.0 28 35.2635 41.0 32.0 41.0 22.0 41.0 29 38.86875 41.0 41.0 41.0 32.0 41.0 30 39.184 41.0 41.0 41.0 37.0 41.0 31 38.77425 41.0 41.0 41.0 32.0 41.0 32 38.53375 41.0 41.0 41.0 32.0 41.0 33 32.85725 37.0 27.0 41.0 12.0 41.0 34 37.62325 41.0 37.0 41.0 27.0 41.0 35 39.007 41.0 41.0 41.0 37.0 41.0 36 39.73375 41.0 41.0 41.0 37.0 41.0 37 39.7785 41.0 41.0 41.0 37.0 41.0 38 38.61375 41.0 41.0 41.0 32.0 41.0 39 38.5005 41.0 41.0 41.0 32.0 41.0 40 38.92475 41.0 41.0 41.0 37.0 41.0 41 39.4715 41.0 41.0 41.0 37.0 41.0 42 39.52475 41.0 41.0 41.0 37.0 41.0 43 39.59925 41.0 41.0 41.0 37.0 41.0 44 38.85325 41.0 41.0 41.0 37.0 41.0 45 39.0015 41.0 41.0 41.0 37.0 41.0 46 32.92425 37.0 27.0 41.0 12.0 41.0 47 37.12175 41.0 37.0 41.0 27.0 41.0 48 37.744 41.0 37.0 41.0 27.0 41.0 49 39.39825 41.0 41.0 41.0 37.0 41.0 50 39.744 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 7.0 26 7.0 27 13.0 28 24.0 29 29.0 30 42.0 31 53.0 32 59.0 33 98.0 34 130.0 35 180.0 36 241.0 37 299.0 38 508.0 39 988.0 40 1317.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.175 10.925 6.05 44.85 2 22.375618650690285 10.445428497004428 39.85412867934358 27.32482417296171 3 21.025 14.149999999999999 24.425 40.400000000000006 4 25.174999999999997 19.125 23.65 32.05 5 27.224999999999998 24.95 25.224999999999998 22.6 6 22.925 29.4 23.525 24.15 7 16.875 24.224999999999998 39.95 18.95 8 18.5 22.275 34.125 25.1 9 19.8 19.6 36.275 24.325 10 22.1 30.45 27.175 20.275000000000002 11 26.075 23.275000000000002 24.95 25.7 12 23.775 21.875 28.15 26.200000000000003 13 22.3 26.0 28.050000000000004 23.65 14 23.175 25.074999999999996 25.974999999999998 25.775 15 24.2 23.525 27.250000000000004 25.025 16 23.9 23.175 25.650000000000002 27.275 17 23.45 24.425 26.1 26.025 18 23.474999999999998 23.95 25.05 27.525 19 22.775000000000002 26.8 26.150000000000002 24.275 20 24.224999999999998 23.65 27.55 24.575 21 22.975 25.025 26.700000000000003 25.3 22 23.849999999999998 26.174999999999997 24.474999999999998 25.5 23 24.95 24.375 26.150000000000002 24.525 24 22.625 24.625 26.450000000000003 26.3 25 23.075000000000003 23.974999999999998 26.674999999999997 26.275 26 23.575 24.224999999999998 26.200000000000003 26.0 27 25.0 23.5 26.224999999999998 25.275 28 23.825 25.424999999999997 25.55 25.2 29 23.0 25.55 26.724999999999998 24.725 30 22.05 23.849999999999998 27.625 26.474999999999998 31 25.15 22.475 25.6 26.775 32 23.9 24.7 26.924999999999997 24.474999999999998 33 23.025000000000002 23.599999999999998 26.275 27.1 34 23.05 24.675 25.324999999999996 26.950000000000003 35 23.599999999999998 24.725 25.85 25.825 36 22.35 23.799999999999997 26.625 27.224999999999998 37 22.85 26.474999999999998 25.724999999999998 24.95 38 23.674999999999997 23.95 27.625 24.75 39 22.85 23.75 27.250000000000004 26.150000000000002 40 24.15 24.7 26.25 24.9 41 22.925 25.55 25.674999999999997 25.85 42 23.1 24.3 27.1 25.5 43 24.375 24.8 25.3 25.525 44 24.474999999999998 24.425 25.674999999999997 25.424999999999997 45 25.174999999999997 23.125 26.275 25.424999999999997 46 25.6 24.025 24.125 26.25 47 23.849999999999998 25.15 26.224999999999998 24.775 48 21.85 24.6 28.050000000000004 25.5 49 25.8 24.275 25.025 24.9 50 24.275 25.05 24.825 25.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.5 22 3.0 23 4.0 24 5.0 25 7.5 26 10.0 27 13.5 28 17.0 29 19.0 30 21.0 31 38.5 32 56.0 33 72.5 34 89.0 35 119.0 36 149.0 37 166.5 38 184.0 39 193.5 40 203.0 41 248.0 42 293.0 43 305.5 44 318.0 45 338.0 46 358.0 47 357.0 48 356.0 49 336.0 50 316.0 51 286.5 52 257.0 53 262.0 54 267.0 55 246.0 56 225.0 57 200.0 58 175.0 59 169.0 60 163.0 61 140.0 62 117.0 63 101.5 64 86.0 65 81.5 66 77.0 67 73.5 68 70.0 69 68.0 70 66.0 71 51.5 72 37.0 73 33.0 74 29.0 75 22.0 76 15.0 77 14.5 78 14.0 79 11.5 80 9.0 81 8.0 82 7.0 83 6.0 84 5.0 85 2.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 4.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.96621078037008 87.6 2 5.148833467417538 9.6 3 0.7240547063555913 2.025 4 0.026816840976133013 0.1 5 0.08045052292839903 0.375 6 0.053633681952266025 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTATGATTAACAGCTGCCCTCGACGAAGAAGTCCATTGAACACATGGCGG 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTAT 6 0.15 TruSeq Adapter, Index 22 (97% over 40bp) CTCCGATCGGGTAACTCTGGCAGCTGCTTTGGGGGAAATTCGGAGTCAAC 5 0.125 No Hit CCTGGCACCTGTTCTGCTGCACTGTAGGCCACGGTCCTAGGATTGACGTC 5 0.125 No Hit CCTTGGATCACGTACACCACGCTATGGGCATTAATGTTCCAGAATGGTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223651 READS because READLEN < 1 Read 1223651 spots for SRR6322440.sra Written 1223651 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra Rejected 1223637 READS because READLEN < 1 Read 1223637 spots for SRR6322440.sra Written 1223637 spots for SRR6322440.sra SRR ids: ['SRR6322440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6p75d1i SRR6322440.sra spots: 24472754 blocks: [[1, 1223637], [1223638, 2447274], [2447275, 3670911], [3670912, 4894548], [4894549, 6118185], [6118186, 7341822], [7341823, 8565459], [8565460, 9789096], [9789097, 11012733], [11012734, 12236370], [12236371, 13460007], [13460008, 14683644], [14683645, 15907281], [15907282, 17130918], [17130919, 18354555], [18354556, 19578192], [19578193, 20801829], [20801830, 22025466], [22025467, 23249103], [23249104, 24472754]] SRR6322440 file size 3419780 SRR6322440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322440 SRR6322440_1.fastq Input file: SRR6322440_1.fastq trimmed: SRR6322440-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:54:52 2024 >> started Sat Dec 7 10:55:13 2024 >> done (21.136s) 24472754 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 64196 ( 0.26%) empty reads filtered out after trimming by size control 24408503 (99.74%) reads available; of these: 12 ( 0.00%) trimmed reads available after processing 24408491 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 6 0.00% 50 24408491 100.00% 24408503 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=2.0 sequence=TTTGGCTTTGGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=43.44 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=4.2 sequence=GCTGCTGCTGCATGATGGCCTGTGCCACGCCGTTGACAGCCTGGCACCGGAACTGCTCTGGGATCTGGGCCAGCTGCTGGCA Started job on | Dec 07 10:55:24 Started mapping on | Dec 07 10:55:24 Finished on | Dec 07 10:55:43 Mapping speed, Million of reads per hour | 4624.77 Number of input reads | 24408503 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20939130 Uniquely mapped reads % | 85.79% Average mapped length | 49.80 Number of splices: Total | 3066356 Number of splices: Annotated (sjdb) | 2937935 Number of splices: GT/AG | 3001537 Number of splices: GC/AG | 37109 Number of splices: AT/AC | 2525 Number of splices: Non-canonical | 25185 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3129547 % of reads mapped to multiple loci | 12.82% Number of reads mapped to too many loci | 215199 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 339826 339826 339826 N_multimapping 3129547 3129547 3129547 N_noFeature 1084730 20571476 1202206 N_ambiguous 286517 1281 36526 UnstrandedReadsAssigned:19567883 PositiveStrandReadsAssigned:366373 NegativeStrandReadsAssigned:19700398 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322440 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322440-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,408,503 reads, 21,520,208 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR6322440.ke.tsv 35125 SRR6322440.se.tsv 88098 total ==> SRR6322440.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 135.988 11.4688 PNS24247 1044 945 70.924 5.29788 PNS24249 1928 1829 345.489 13.334 PNS24246 1044 945 70.924 5.29788 PNS24248 1044 945 70.924 5.29788 PNS24244 1471 1372 59.7504 3.07416 PNS24243 293 194 0 0 KQK14069 1603 1504 905.948 42.5202 KQK14071 474 375 172.149 32.4051 ==> SRR6322440.se.tsv <== BRADI_1g14170v3 1247 BRADI_1g53295v3 465 BRADI_1g59795v3 200 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 1205 BRADI_1g74790v3 9 BRADI_1g09890v3 0 BRADI_1g77505v3 546 BRADI_1g48960v3 0 SRR6322440 completed mapping pipeline successfully