Starting /dee2/code/volunteer_pipeline.sh SRR6322442 current disk space = 1543162208256 free memory = 1598930948 SRR6322442 SRAfilesize 736ed6b0077d90dfe7a55d59047c93f6 SRR6322442.sra SRR6322442.sra file validated SRR6322442 is single end SRR6322442 is conventional basespace SRR6322442 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69925 34.0 33.0 34.0 31.0 34.0 2 32.59075 34.0 34.0 34.0 31.0 34.0 3 33.122 34.0 34.0 34.0 31.0 34.0 4 36.591 37.0 37.0 37.0 35.0 37.0 5 36.68575 37.0 37.0 37.0 37.0 37.0 6 36.675 37.0 37.0 37.0 37.0 37.0 7 36.64 37.0 37.0 37.0 36.0 37.0 8 36.6695 37.0 37.0 37.0 37.0 37.0 9 38.61875 39.0 39.0 39.0 38.0 39.0 10-14 38.9204 39.4 39.2 39.4 38.2 39.4 15-19 40.072 41.0 40.0 41.0 38.2 41.0 20-24 39.96445 41.0 40.0 41.0 38.0 41.0 25-29 39.54835 41.0 39.8 41.0 37.0 41.0 30-34 39.188599999999994 40.8 38.8 41.0 35.4 41.0 35-39 38.88035 41.0 38.6 41.0 35.0 41.0 40-44 38.362700000000004 40.0 36.8 41.0 35.0 41.0 45-49 37.7236 39.8 35.0 41.0 33.6 41.0 50-54 36.91674999999999 38.6 35.0 40.6 33.0 41.0 55-59 36.398300000000006 37.2 35.0 40.6 32.8 41.0 60-64 35.952600000000004 35.8 35.0 39.8 33.0 41.0 65-69 35.31705 35.0 35.0 38.4 32.6 41.0 70-74 34.670249999999996 35.0 35.0 36.8 32.2 39.4 75-79 33.80845000000001 35.0 34.2 35.4 30.8 37.4 80-84 33.37955 35.0 34.0 35.0 30.2 36.4 85-89 33.07115 35.0 34.0 35.0 30.0 35.8 90-94 32.6579 35.0 33.4 35.0 29.0 35.0 95-99 32.34745 35.0 33.0 35.0 28.2 35.0 100-104 31.870000000000005 35.0 33.0 35.0 25.4 35.0 105-109 31.534399999999998 35.0 32.8 35.0 24.4 35.0 110-114 30.861699999999995 34.6 31.4 35.0 21.4 35.0 115-119 30.37575 34.0 31.0 35.0 19.4 35.0 120-124 29.517200000000003 34.0 29.4 35.0 10.8 35.0 125-129 28.84865 34.0 29.0 35.0 3.0 35.0 130-134 28.040099999999995 33.6 27.8 35.0 2.0 35.0 135-139 26.85605 33.0 24.8 35.0 2.0 35.0 140-144 26.018600000000003 33.0 23.2 35.0 2.0 35.0 145-149 24.36995 32.0 11.0 34.0 2.0 35.0 150 17.77275 23.0 2.0 30.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 4.0 6 2.0 7 2.0 8 10.0 9 4.0 10 7.0 11 7.0 12 4.0 13 5.0 14 4.0 15 10.0 16 11.0 17 13.0 18 11.0 19 17.0 20 17.0 21 27.0 22 24.0 23 32.0 24 35.0 25 46.0 26 56.0 27 62.0 28 70.0 29 91.0 30 106.0 31 126.0 32 200.0 33 244.0 34 393.0 35 684.0 36 1028.0 37 641.0 38 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.139878595935603 14.119820533122196 11.797307996832936 43.942992874109265 2 32.96648324162081 16.783391695847925 19.634817408704354 30.61530765382691 3 25.1 19.225 18.55 37.125 4 29.299999999999997 20.575 17.549999999999997 32.574999999999996 5 31.324999999999996 23.575 20.150000000000002 24.95 6 29.15 26.375 19.275000000000002 25.2 7 23.275000000000002 23.5 30.725 22.5 8 27.675 21.475 23.05 27.800000000000004 9 26.35 20.474999999999998 25.85 27.325 10-14 26.875 24.235 21.925 26.965 15-19 27.255000000000003 22.830000000000002 22.33 27.584999999999997 20-24 27.950000000000003 23.305 21.68 27.065 25-29 27.13 22.8 22.05 28.02 30-34 27.325 22.18 22.2 28.294999999999998 35-39 27.405 22.900000000000002 22.1 27.595 40-44 27.785 22.770000000000003 21.69 27.755000000000003 45-49 27.26 23.095 22.065 27.58 50-54 28.050000000000004 22.3 22.025 27.625 55-59 27.794999999999998 22.435 22.205 27.565 60-64 27.275 22.615 22.585 27.525 65-69 27.555000000000003 22.189999999999998 22.435 27.82 70-74 27.57 22.355 22.03 28.044999999999998 75-79 27.474999999999998 22.55 21.82 28.155 80-84 27.944999999999997 22.915 21.654999999999998 27.485 85-89 27.500000000000004 22.225 21.93 28.345 90-94 27.915 22.125 22.025 27.935 95-99 28.215 22.33 21.884999999999998 27.57 100-104 28.46 21.81 22.040000000000003 27.689999999999998 105-109 28.185 21.95 22.134999999999998 27.73 110-114 28.13 22.33 22.105 27.435 115-119 28.305000000000003 22.2 21.834999999999997 27.66 120-124 28.275 22.29 21.595 27.839999999999996 125-129 28.68 22.23 21.865000000000002 27.224999999999998 130-134 28.615000000000002 22.31 21.505 27.57 135-139 28.515 22.18 21.55 27.755000000000003 140-144 28.78 21.89 21.8 27.529999999999998 145-149 28.965000000000003 21.98 21.6 27.455000000000002 150 30.675 20.05 18.9 30.375000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 1.0 28 1.0 29 1.5 30 2.0 31 2.5 32 4.0 33 6.0 34 12.5 35 14.5 36 17.5 37 30.5 38 45.5 39 55.5 40 63.5 41 86.0 42 109.0 43 115.0 44 127.5 45 140.5 46 151.0 47 150.5 48 129.0 49 121.0 50 122.5 51 129.5 52 132.0 53 121.5 54 103.0 55 97.5 56 108.0 57 98.0 58 84.0 59 84.5 60 88.5 61 87.5 62 82.5 63 82.5 64 84.5 65 92.5 66 96.5 67 89.5 68 83.0 69 86.0 70 88.5 71 87.0 72 77.5 73 70.5 74 70.0 75 57.0 76 43.5 77 36.0 78 30.0 79 26.0 80 18.0 81 10.5 82 10.0 83 9.5 84 6.5 85 3.0 86 2.5 87 1.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.2749999999999995 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.07500000000000001 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1125 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.275 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.175 0.0 0.0 0.0 0.0 136-137 1.4500000000000002 0.0 0.0 0.0 0.0 138 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCCAA 10 0.006973645 144.0 6 >>END_MODULE Read 2436904 spots for SRR6322442.sra Written 2436904 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra Read 2436890 spots for SRR6322442.sra Written 2436890 spots for SRR6322442.sra SRR ids: ['SRR6322442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8j40vzjq SRR6322442.sra spots: 48737814 blocks: [[1, 2436890], [2436891, 4873780], [4873781, 7310670], [7310671, 9747560], [9747561, 12184450], [12184451, 14621340], [14621341, 17058230], [17058231, 19495120], [19495121, 21932010], [21932011, 24368900], [24368901, 26805790], [26805791, 29242680], [29242681, 31679570], [31679571, 34116460], [34116461, 36553350], [36553351, 38990240], [38990241, 41427130], [41427131, 43864020], [43864021, 46300910], [46300911, 48737814]] SRR6322442 file size 17934112 SRR6322442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322442 SRR6322442_1.fastq Input file: SRR6322442_1.fastq trimmed: SRR6322442-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:31:24 2024 >> started Sat Dec 7 12:31:58 2024 >> done (34.389s) 48737814 reads processed; of these: 57727 ( 0.12%) short reads filtered out after trimming by size control 43646 ( 0.09%) empty reads filtered out after trimming by size control 48636441 (99.79%) reads available; of these: 25557027 (52.55%) trimmed reads available after processing 23079414 (47.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6470 0.01% 19 7289 0.01% 20 7795 0.02% 21 8259 0.02% 22 8451 0.02% 23 9265 0.02% 24 10028 0.02% 25 11253 0.02% 26 13121 0.03% 27 12298 0.03% 28 12530 0.03% 29 13566 0.03% 30 13291 0.03% 31 13968 0.03% 32 14676 0.03% 33 14736 0.03% 34 14988 0.03% 35 15398 0.03% 36 15736 0.03% 37 16145 0.03% 38 16104 0.03% 39 17419 0.04% 40 17417 0.04% 41 18024 0.04% 42 18694 0.04% 43 19572 0.04% 44 19257 0.04% 45 19582 0.04% 46 20717 0.04% 47 21741 0.04% 48 22329 0.05% 49 22197 0.05% 50 22279 0.05% 51 19018 0.04% 52 18806 0.04% 53 20221 0.04% 54 20286 0.04% 55 20815 0.04% 56 21236 0.04% 57 21529 0.04% 58 21132 0.04% 59 21321 0.04% 60 22268 0.05% 61 23200 0.05% 62 24261 0.05% 63 25042 0.05% 64 26601 0.05% 65 31041 0.06% 66 30963 0.06% 67 30951 0.06% 68 31804 0.07% 69 31820 0.07% 70 32439 0.07% 71 34745 0.07% 72 37090 0.08% 73 38387 0.08% 74 39358 0.08% 75 39771 0.08% 76 34787 0.07% 77 36975 0.08% 78 41651 0.09% 79 42933 0.09% 80 46144 0.09% 81 50306 0.10% 82 51609 0.11% 83 53847 0.11% 84 56234 0.12% 85 59395 0.12% 86 60336 0.12% 87 63630 0.13% 88 64946 0.13% 89 67470 0.14% 90 70251 0.14% 91 72589 0.15% 92 75586 0.16% 93 79180 0.16% 94 82840 0.17% 95 87223 0.18% 96 91081 0.19% 97 94669 0.19% 98 99624 0.20% 99 102752 0.21% 100 106756 0.22% 101 112917 0.23% 102 117333 0.24% 103 120781 0.25% 104 126464 0.26% 105 132109 0.27% 106 135070 0.28% 107 141351 0.29% 108 145122 0.30% 109 151529 0.31% 110 162033 0.33% 111 168851 0.35% 112 177435 0.36% 113 186446 0.38% 114 198686 0.41% 115 211989 0.44% 116 226401 0.47% 117 229472 0.47% 118 226110 0.46% 119 228965 0.47% 120 233684 0.48% 121 237574 0.49% 122 247083 0.51% 123 252346 0.52% 124 260216 0.54% 125 272149 0.56% 126 277184 0.57% 127 285035 0.59% 128 303623 0.62% 129 314459 0.65% 130 328923 0.68% 131 349252 0.72% 132 363814 0.75% 133 385646 0.79% 134 406540 0.84% 135 414702 0.85% 136 426391 0.88% 137 450607 0.93% 138 474259 0.98% 139 505836 1.04% 140 554753 1.14% 141 601539 1.24% 142 667188 1.37% 143 748190 1.54% 144 844603 1.74% 145 982773 2.02% 146 1188587 2.44% 147 1416496 2.91% 148 1804432 3.71% 149 3888565 8.00% 150 23079414 47.45% 48636441 reads passed initial QC criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=72.86 fanout-score-rank=9 prefix-density=1.94 prefix-fanout=47.3 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=320.11 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=27.6 sequence=CGGCGGCGGCGCC Started job on | Dec 07 12:32:21 Started mapping on | Dec 07 12:32:21 Finished on | Dec 07 12:33:28 Mapping speed, Million of reads per hour | 2613.30 Number of input reads | 48636441 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 46095126 Uniquely mapped reads % | 94.77% Average mapped length | 138.70 Number of splices: Total | 18319599 Number of splices: Annotated (sjdb) | 17325058 Number of splices: GT/AG | 18066621 Number of splices: GC/AG | 202461 Number of splices: AT/AC | 11498 Number of splices: Non-canonical | 39019 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 838139 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 1243046 % of reads mapped to too many loci | 2.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1703176 1703176 1703176 N_multimapping 838139 838139 838139 N_noFeature 1111397 23338840 23247605 N_ambiguous 705264 45988 48437 UnstrandedReadsAssigned:44278465 PositiveStrandReadsAssigned:22710298 NegativeStrandReadsAssigned:22799084 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR6322442 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322442-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,636,441 reads, 45,514,044 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,301 rounds 52973 SRR6322442.ke.tsv 35125 SRR6322442.se.tsv 88098 total ==> SRR6322442.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 74.584 2.7786 PNS24249 1928 1829 949.496 18.2765 PNS24246 1044 945 74.584 2.7786 PNS24248 1044 945 74.584 2.7786 PNS24244 1471 1372 79.7517 2.04644 PNS24243 293 194 17 3.08503 KQK14069 1603 1504 15016.8 351.514 KQK14071 474 375 3115.53 292.491 ==> SRR6322442.se.tsv <== BRADI_1g14170v3 18561 BRADI_1g53295v3 503 BRADI_1g59795v3 467 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 997 BRADI_1g74790v3 855 BRADI_1g09890v3 0 BRADI_1g77505v3 391 BRADI_1g48960v3 0 SRR6322442 completed mapping pipeline successfully