Starting /dee2/code/volunteer_pipeline.sh SRR6322444 current disk space = 1543310385152 free memory = 1606395784 SRR6322444 SRAfilesize fa96148372f1d01c5f644e72ffbc8bb0 SRR6322444.sra SRR6322444.sra file validated SRR6322444 is single end SRR6322444 is conventional basespace SRR6322444 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.65625 32.0 32.0 32.0 27.0 32.0 2 31.0975 32.0 32.0 32.0 32.0 32.0 3 34.745 37.0 32.0 37.0 32.0 37.0 4 35.705 37.0 37.0 37.0 32.0 37.0 5 36.635 37.0 37.0 37.0 37.0 37.0 6 39.8945 41.0 41.0 41.0 37.0 41.0 7 39.6845 41.0 41.0 41.0 37.0 41.0 8 39.61725 41.0 41.0 41.0 37.0 41.0 9 39.95925 41.0 41.0 41.0 37.0 41.0 10 40.428 41.0 41.0 41.0 41.0 41.0 11 40.11475 41.0 41.0 41.0 37.0 41.0 12 40.2585 41.0 41.0 41.0 41.0 41.0 13 40.19675 41.0 41.0 41.0 37.0 41.0 14 39.64675 41.0 41.0 41.0 37.0 41.0 15 39.63875 41.0 41.0 41.0 37.0 41.0 16 39.202 41.0 41.0 41.0 37.0 41.0 17 40.0995 41.0 41.0 41.0 37.0 41.0 18 40.08925 41.0 41.0 41.0 37.0 41.0 19 39.63825 41.0 41.0 41.0 37.0 41.0 20 39.1995 41.0 41.0 41.0 37.0 41.0 21 40.17225 41.0 41.0 41.0 37.0 41.0 22 39.68 41.0 41.0 41.0 37.0 41.0 23 39.4615 41.0 41.0 41.0 37.0 41.0 24 39.59475 41.0 41.0 41.0 37.0 41.0 25 40.09725 41.0 41.0 41.0 37.0 41.0 26 39.78875 41.0 41.0 41.0 37.0 41.0 27 39.8665 41.0 41.0 41.0 37.0 41.0 28 38.5665 41.0 41.0 41.0 32.0 41.0 29 39.52025 41.0 41.0 41.0 37.0 41.0 30 39.54525 41.0 41.0 41.0 37.0 41.0 31 38.09975 41.0 37.0 41.0 27.0 41.0 32 39.04275 41.0 41.0 41.0 37.0 41.0 33 37.91325 41.0 37.0 41.0 27.0 41.0 34 39.059 41.0 41.0 41.0 37.0 41.0 35 38.56125 41.0 41.0 41.0 32.0 41.0 36 39.30575 41.0 41.0 41.0 37.0 41.0 37 38.57475 41.0 41.0 41.0 32.0 41.0 38 38.47425 41.0 41.0 41.0 32.0 41.0 39 39.7625 41.0 41.0 41.0 37.0 41.0 40 39.99175 41.0 41.0 41.0 37.0 41.0 41 35.80625 41.0 37.0 41.0 22.0 41.0 42 38.43625 41.0 37.0 41.0 32.0 41.0 43 39.704 41.0 41.0 41.0 37.0 41.0 44 38.76475 41.0 41.0 41.0 32.0 41.0 45 33.3155 41.0 27.0 41.0 12.0 41.0 46 38.773 41.0 37.0 41.0 32.0 41.0 47 37.339 41.0 37.0 41.0 27.0 41.0 48 37.00625 41.0 37.0 41.0 27.0 41.0 49 37.263 41.0 37.0 41.0 27.0 41.0 50 38.27875 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 2.0 25 5.0 26 7.0 27 13.0 28 18.0 29 34.0 30 44.0 31 63.0 32 60.0 33 88.0 34 107.0 35 153.0 36 172.0 37 273.0 38 400.0 39 922.0 40 1637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.769769769769766 10.735735735735735 8.383383383383384 36.11111111111111 2 27.180010198878122 10.351861295257523 32.27944926058134 30.18867924528302 3 23.0 17.7 23.425 35.875 4 27.05 21.099999999999998 22.35 29.5 5 26.775 25.424999999999997 24.625 23.175 6 23.25 30.425 22.900000000000002 23.425 7 20.225 23.1 37.5 19.175 8 20.8 22.275 28.625 28.299999999999997 9 19.025 21.575 33.6 25.8 10 21.575 31.275 25.4 21.75 11 27.35 22.025 21.7 28.925 12 23.849999999999998 21.8 26.075 28.275 13 23.05 25.05 26.5 25.4 14 23.575 24.099999999999998 26.5 25.825 15 24.875 24.275 24.725 26.125 16 23.525 25.025 24.8 26.650000000000002 17 23.65 23.575 24.775 28.000000000000004 18 22.825 24.975 25.924999999999997 26.275 19 24.675 23.0 25.1 27.224999999999998 20 23.400000000000002 24.3 26.400000000000002 25.900000000000002 21 24.575 24.025 24.4 27.0 22 24.875 24.4 24.975 25.75 23 23.625 23.200000000000003 26.05 27.125 24 22.225 24.9 25.900000000000002 26.974999999999998 25 24.3 24.925 23.674999999999997 27.1 26 24.575 24.75 25.85 24.825 27 21.9 25.05 26.0 27.05 28 23.075000000000003 25.1 25.25 26.575 29 24.7 23.974999999999998 23.974999999999998 27.35 30 23.625 24.525 25.275 26.575 31 24.375 23.825 25.775 26.025 32 23.400000000000002 24.125 25.25 27.224999999999998 33 24.55 23.474999999999998 25.55 26.424999999999997 34 24.8 24.375 24.349999999999998 26.474999999999998 35 23.674999999999997 25.45 25.1 25.775 36 23.3 24.025 26.075 26.6 37 24.9 23.925 24.15 27.025 38 24.625 24.7 24.275 26.400000000000002 39 24.05 23.95 25.900000000000002 26.1 40 24.3 24.15 24.7 26.85 41 23.9 23.974999999999998 26.075 26.05 42 24.775 23.625 24.45 27.150000000000002 43 24.525 24.825 23.825 26.825 44 25.2 23.825 24.099999999999998 26.875 45 23.95 23.35 25.775 26.924999999999997 46 25.95 24.25 24.4 25.4 47 25.775 23.150000000000002 24.55 26.525 48 23.825 24.4 25.025 26.75 49 24.175 23.799999999999997 25.424999999999997 26.6 50 24.05 24.6 23.849999999999998 27.500000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 3.5 24 6.0 25 5.5 26 5.0 27 15.5 28 26.0 29 29.0 30 32.0 31 43.0 32 54.0 33 67.0 34 80.0 35 107.0 36 134.0 37 150.0 38 166.0 39 194.0 40 222.0 41 255.0 42 288.0 43 296.5 44 305.0 45 312.5 46 320.0 47 311.0 48 302.0 49 276.0 50 250.0 51 246.5 52 243.0 53 226.5 54 210.0 55 193.0 56 176.0 57 171.0 58 166.0 59 164.0 60 162.0 61 155.0 62 148.0 63 149.5 64 151.0 65 134.5 66 118.0 67 116.5 68 115.0 69 103.5 70 92.0 71 84.0 72 76.0 73 62.0 74 48.0 75 45.5 76 43.0 77 36.5 78 30.0 79 22.5 80 15.0 81 11.0 82 7.0 83 6.5 84 6.0 85 3.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 1.95 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.59748427672956 91.2 2 4.061844863731656 7.75 3 0.2882599580712788 0.8250000000000001 4 0.026205450733752623 0.1 5 0.026205450733752623 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGCAGGTTCAGTACATCCCTTTGAAGACTGGATTTGATCGGCAGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550871 READS because READLEN < 1 Read 1550871 spots for SRR6322444.sra Written 1550871 spots for SRR6322444.sra Rejected 1550873 READS because READLEN < 1 Read 1550873 spots for SRR6322444.sra Written 1550873 spots for SRR6322444.sra SRR ids: ['SRR6322444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1jy5n4uz SRR6322444.sra spots: 31017422 blocks: [[1, 1550871], [1550872, 3101742], [3101743, 4652613], [4652614, 6203484], [6203485, 7754355], [7754356, 9305226], [9305227, 10856097], [10856098, 12406968], [12406969, 13957839], [13957840, 15508710], [15508711, 17059581], [17059582, 18610452], [18610453, 20161323], [20161324, 21712194], [21712195, 23263065], [23263066, 24813936], [24813937, 26364807], [26364808, 27915678], [27915679, 29466549], [29466550, 31017422]] SRR6322444 file size 4340124 SRR6322444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322444 SRR6322444_1.fastq Input file: SRR6322444_1.fastq trimmed: SRR6322444-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:56:30 2024 >> started Sat Dec 7 10:56:54 2024 >> done (24.080s) 31017422 reads processed; of these: 94 ( 0.00%) short reads filtered out after trimming by size control 23401 ( 0.08%) empty reads filtered out after trimming by size control 30993927 (99.92%) reads available; of these: 3471 ( 0.01%) trimmed reads available after processing 30990456 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3451 0.01% 50 30990456 99.99% 30993927 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=12.84 fanout-score-rank=5 prefix-density=0.96 prefix-fanout=3.8 sequence=TGCTGCTGCTGCCCACGTCCTTGTTGGCGTTCCTCTCGCTCGTCCTCGGAGGACTGCTCTTCCTGTTGTTGTCGCTCGCTCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=57.95 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.2 sequence=TCGCCGCCGCCAGCTCCAGCCTCATGCGCTTTGCTCTGGATGGCCTGCCCAGCCTGCTGCGTCTTGTGGCCCGCCGCCGCG Started job on | Dec 07 10:57:05 Started mapping on | Dec 07 10:57:05 Finished on | Dec 07 10:57:34 Mapping speed, Million of reads per hour | 3847.52 Number of input reads | 30993927 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 29518115 Uniquely mapped reads % | 95.24% Average mapped length | 49.80 Number of splices: Total | 3897821 Number of splices: Annotated (sjdb) | 3759465 Number of splices: GT/AG | 3842714 Number of splices: GC/AG | 44977 Number of splices: AT/AC | 3048 Number of splices: Non-canonical | 7082 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 849740 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 414199 % of reads mapped to too many loci | 1.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 626072 626072 626072 N_multimapping 849740 849740 849740 N_noFeature 1493576 28976360 1716443 N_ambiguous 345663 2268 26704 UnstrandedReadsAssigned:27678876 PositiveStrandReadsAssigned:539487 NegativeStrandReadsAssigned:27774968 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322444 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322444-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,993,927 reads, 27,563,450 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52973 SRR6322444.ke.tsv 35125 SRR6322444.se.tsv 88098 total ==> SRR6322444.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 143.149 10.3055 PNS24247 1044 945 84.9645 5.41765 PNS24249 1928 1829 568.787 18.7388 PNS24246 1044 945 84.9645 5.41765 PNS24248 1044 945 84.9645 5.41765 PNS24244 1471 1372 29.1699 1.28111 PNS24243 293 194 0 0 KQK14069 1603 1504 50.6218 2.02812 KQK14071 474 375 11.4127 1.83384 ==> SRR6322444.se.tsv <== BRADI_1g14170v3 63 BRADI_1g53295v3 1545 BRADI_1g59795v3 689 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 1871 BRADI_1g74790v3 6 BRADI_1g09890v3 0 BRADI_1g77505v3 556 BRADI_1g48960v3 1 SRR6322444 completed mapping pipeline successfully