Starting /dee2/code/volunteer_pipeline.sh SRR6322445 current disk space = 1543391137792 free memory = 1603831228 SRR6322445 SRAfilesize da3888553be05ddc00f1e92c7da3c918 SRR6322445.sra SRR6322445.sra file validated SRR6322445 is single end SRR6322445 is conventional basespace SRR6322445 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.40875 32.0 32.0 32.0 32.0 32.0 2 30.58375 32.0 32.0 32.0 32.0 32.0 3 32.625 32.0 32.0 37.0 27.0 37.0 4 36.13875 37.0 37.0 37.0 32.0 37.0 5 35.95875 37.0 37.0 37.0 32.0 37.0 6 40.24225 41.0 41.0 41.0 37.0 41.0 7 37.991 41.0 37.0 41.0 32.0 41.0 8 39.99475 41.0 41.0 41.0 37.0 41.0 9 38.373 41.0 37.0 41.0 32.0 41.0 10 40.252 41.0 41.0 41.0 37.0 41.0 11 40.504 41.0 41.0 41.0 41.0 41.0 12 40.2835 41.0 41.0 41.0 37.0 41.0 13 39.602 41.0 41.0 41.0 37.0 41.0 14 38.1425 41.0 37.0 41.0 32.0 41.0 15 39.58775 41.0 41.0 41.0 37.0 41.0 16 39.5165 41.0 41.0 41.0 37.0 41.0 17 40.28 41.0 41.0 41.0 37.0 41.0 18 39.8095 41.0 41.0 41.0 37.0 41.0 19 40.29425 41.0 41.0 41.0 41.0 41.0 20 40.06975 41.0 41.0 41.0 37.0 41.0 21 40.209 41.0 41.0 41.0 37.0 41.0 22 40.34925 41.0 41.0 41.0 41.0 41.0 23 39.718 41.0 41.0 41.0 37.0 41.0 24 37.37625 41.0 37.0 41.0 27.0 41.0 25 37.43575 41.0 37.0 41.0 27.0 41.0 26 37.29475 41.0 37.0 41.0 27.0 41.0 27 39.26925 41.0 41.0 41.0 37.0 41.0 28 37.493 41.0 37.0 41.0 27.0 41.0 29 37.748 41.0 37.0 41.0 27.0 41.0 30 38.2075 41.0 37.0 41.0 32.0 41.0 31 34.14775 41.0 32.0 41.0 12.0 41.0 32 34.71925 41.0 32.0 41.0 22.0 41.0 33 35.4165 41.0 32.0 41.0 22.0 41.0 34 30.758 37.0 22.0 41.0 12.0 41.0 35 37.98075 41.0 37.0 41.0 32.0 41.0 36 38.96 41.0 41.0 41.0 37.0 41.0 37 33.66975 41.0 27.0 41.0 12.0 41.0 38 38.3025 41.0 37.0 41.0 32.0 41.0 39 39.609 41.0 41.0 41.0 37.0 41.0 40 39.19625 41.0 41.0 41.0 37.0 41.0 41 39.03525 41.0 41.0 41.0 37.0 41.0 42 39.66025 41.0 41.0 41.0 37.0 41.0 43 39.2975 41.0 41.0 41.0 37.0 41.0 44 39.896 41.0 41.0 41.0 37.0 41.0 45 39.56875 41.0 41.0 41.0 37.0 41.0 46 38.63975 41.0 41.0 41.0 32.0 41.0 47 37.77175 41.0 37.0 41.0 27.0 41.0 48 39.34 41.0 41.0 41.0 37.0 41.0 49 39.5265 41.0 41.0 41.0 37.0 41.0 50 38.2305 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 6.0 26 4.0 27 8.0 28 24.0 29 29.0 30 32.0 31 57.0 32 75.0 33 102.0 34 140.0 35 220.0 36 282.0 37 446.0 38 685.0 39 975.0 40 912.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.45181476846058 8.435544430538172 8.285356695869837 41.82728410513141 2 25.91353576942872 7.822954194544519 38.88317035512095 27.380339680905813 3 25.75 12.7 24.525 37.025000000000006 4 29.325000000000003 17.2 23.325000000000003 30.15 5 31.075000000000003 20.65 26.5 21.775 6 23.325000000000003 25.825 27.075 23.775 7 21.55 20.7 40.425 17.325 8 22.875 19.275000000000002 30.975 26.875 9 21.775 17.2 35.699999999999996 25.324999999999996 10 25.124999999999996 26.8 27.6 20.474999999999998 11 28.7 20.200000000000003 23.65 27.450000000000003 12 26.924999999999997 18.575 28.199999999999996 26.3 13 25.724999999999998 21.85 26.900000000000002 25.525 14 25.650000000000002 21.575 26.974999999999998 25.8 15 26.924999999999997 21.325 25.4 26.35 16 26.375 20.674999999999997 26.05 26.900000000000002 17 26.75 22.125 25.4 25.724999999999998 18 25.7 22.6 24.349999999999998 27.35 19 25.0 22.275 24.55 28.175 20 28.15 19.925 26.575 25.35 21 26.6 20.95 24.375 28.075 22 27.425 20.95 23.825 27.800000000000004 23 27.450000000000003 20.25 23.400000000000002 28.9 24 27.025 20.275000000000002 25.124999999999996 27.575 25 26.375 21.275 25.174999999999997 27.175 26 27.325 22.125 24.575 25.974999999999998 27 26.174999999999997 22.375 25.85 25.6 28 26.775 21.525 25.4 26.3 29 25.624999999999996 22.025 25.85 26.5 30 26.224999999999998 22.0 24.925 26.85 31 26.0 22.275 24.575 27.150000000000002 32 26.825 20.325 27.175 25.674999999999997 33 26.75 20.5 24.65 28.1 34 27.575 20.674999999999997 23.275000000000002 28.475 35 24.3 22.175 26.0 27.525 36 25.374999999999996 20.375 25.35 28.9 37 27.800000000000004 19.85 25.650000000000002 26.700000000000003 38 27.35 20.599999999999998 24.925 27.125 39 26.55 19.900000000000002 26.1 27.450000000000003 40 26.85 20.525 25.224999999999998 27.400000000000002 41 26.974999999999998 19.525000000000002 24.7 28.799999999999997 42 25.45 22.400000000000002 25.900000000000002 26.25 43 26.875 19.75 24.825 28.549999999999997 44 26.924999999999997 19.725 26.05 27.3 45 26.125 21.2 25.4 27.275 46 25.924999999999997 20.349999999999998 25.15 28.575 47 27.325 22.075 23.599999999999998 27.0 48 25.374999999999996 20.175 25.55 28.9 49 26.1 21.075 26.075 26.75 50 26.700000000000003 21.15 25.025 27.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 2.5 24 4.0 25 4.0 26 4.0 27 6.0 28 8.0 29 11.0 30 14.0 31 17.5 32 21.0 33 35.0 34 49.0 35 69.0 36 89.0 37 107.5 38 126.0 39 143.0 40 160.0 41 197.5 42 235.0 43 252.5 44 270.0 45 266.5 46 263.0 47 272.0 48 281.0 49 256.5 50 232.0 51 244.0 52 256.0 53 247.0 54 238.0 55 234.5 56 231.0 57 212.5 58 194.0 59 202.5 60 211.0 61 209.0 62 207.0 63 188.5 64 170.0 65 158.5 66 147.0 67 152.5 68 158.0 69 162.0 70 166.0 71 129.5 72 93.0 73 80.0 74 67.0 75 53.5 76 40.0 77 37.5 78 35.0 79 28.0 80 21.0 81 12.5 82 4.0 83 3.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 2.85 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.5 #Duplication Level Percentage of deduplicated Percentage of total 1 89.59537572254335 77.5 2 7.427745664739885 12.85 3 1.7341040462427744 4.5 4 0.7514450867052023 2.6 5 0.26011560693641617 1.125 6 0.08670520231213873 0.44999999999999996 7 0.05780346820809249 0.35000000000000003 8 0.05780346820809249 0.4 9 0.028901734104046246 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTATGATTAACAGCTGCCCTCGACGAAGAAGTCCATTGAACACATTGCGG 9 0.22499999999999998 No Hit CTGGTATCCTTCACTCTCCGCCTTCTTTAAAACGACATAGTTTTGTGGTA 8 0.2 No Hit CGTCATTCTGATTCTGAATTATTCGTGATGTTTGTTCATTGATACCAAAG 8 0.2 No Hit CTAATAGTTATCATACTAACTCATTCACTCCTGTGCCTTAGGGGTCGAAG 7 0.17500000000000002 No Hit GGGAAATTCTGACCGTTGAGGCGTGCGATACTGCCAGCACGTGGGTTGTA 7 0.17500000000000002 No Hit GGGGATCTTCTGGAGGCTCGCGACCTGTGACGAGAAGGAGAGCGGCGAGG 6 0.15 No Hit GTTATTTTTAAGGTTTTGAGCTTCTTGCCTAGAGATGCGGTACGCATTGG 6 0.15 No Hit GGGATGATTAATAGTTGCCCCGAACGAAGAAGGCCATTGAACACATTTTG 6 0.15 No Hit CTCGACGAAGAAGTCCATTGAACACATTGCGGCCTTGATTGTTAACAACC 5 0.125 No Hit GTTTGTTCATTGATACCAAAGGCCTGGCTAAGCAACTGGGCATTTAAACC 5 0.125 No Hit CTCTGGATGGGTTTGCTCAGGCTTGACACGAGCGAATCGGCACGGAAATA 5 0.125 No Hit GGGCATTAATGTTCCAGAATGGTGAAACAATCGCATTCTTCTGGAGATTT 5 0.125 No Hit GTCCTTCCTGAGGTTCGATTGGTAGGAAGGGTTGTTTCTGCTGTTGTTGG 5 0.125 No Hit CTTTATTTGTCACCGTTGCTACATCCACTAACCAACGGTGATCCATCTAT 5 0.125 No Hit CTCTCATCTTGTTGTTGATGTGGGCACGGCTGCTCCGGCTGAACCGACCA 5 0.125 No Hit GTCCGAATGGCTGATCAGCGGCGGTGGCGCGGCAGTACGGTGGGAGGTAC 5 0.125 No Hit GTTGTATGTGTCGGCACGGTTGGGATCCTCGATGTTTTGCCTTGGCTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872730 READS because READLEN < 1 Read 1872730 spots for SRR6322445.sra Written 1872730 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra Rejected 1872719 READS because READLEN < 1 Read 1872719 spots for SRR6322445.sra Written 1872719 spots for SRR6322445.sra SRR ids: ['SRR6322445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5fad7_s2 SRR6322445.sra spots: 37454391 blocks: [[1, 1872719], [1872720, 3745438], [3745439, 5618157], [5618158, 7490876], [7490877, 9363595], [9363596, 11236314], [11236315, 13109033], [13109034, 14981752], [14981753, 16854471], [16854472, 18727190], [18727191, 20599909], [20599910, 22472628], [22472629, 24345347], [24345348, 26218066], [26218067, 28090785], [28090786, 29963504], [29963505, 31836223], [31836224, 33708942], [33708943, 35581661], [35581662, 37454391]] SRR6322445 file size 5245323 SRR6322445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322445 SRR6322445_1.fastq Input file: SRR6322445_1.fastq trimmed: SRR6322445-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 10:59:00 2024 >> started Sat Dec 7 10:59:24 2024 >> done (23.932s) 37454391 reads processed; of these: 137 ( 0.00%) short reads filtered out after trimming by size control 30750 ( 0.08%) empty reads filtered out after trimming by size control 37423504 (99.92%) reads available; of these: 31 ( 0.00%) trimmed reads available after processing 37423473 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 31 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 37423473 100.00% 37423504 reads passed initial QC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=22 prefix-density=1.20 prefix-fanout=2.9 sequence=CGAGGACGGGTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=38.28 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=1.7 sequence=GCTGCTGCCGCCGCCACCACACGGGTGCTACTTCTTGTTCGCGCCCCTGCTGCAGTTGTCTCTCATCTTGTTGTTGATGTGGGCACGGCTGCTCCGGCTGAACCGACCATGGTTTCTCCTGCGCCATGCCCTGGCTACATCTAGTCTCTCGCTGTGCAATGGTGGTGCTAGC Started job on | Dec 07 10:59:36 Started mapping on | Dec 07 10:59:36 Finished on | Dec 07 11:00:04 Mapping speed, Million of reads per hour | 4811.59 Number of input reads | 37423504 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 29423371 Uniquely mapped reads % | 78.62% Average mapped length | 49.81 Number of splices: Total | 2599542 Number of splices: Annotated (sjdb) | 2464112 Number of splices: GT/AG | 2519435 Number of splices: GC/AG | 30886 Number of splices: AT/AC | 1228 Number of splices: Non-canonical | 47993 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 6508197 % of reads mapped to multiple loci | 17.39% Number of reads mapped to too many loci | 1313770 % of reads mapped to too many loci | 3.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1491936 1491936 1491936 N_multimapping 6508197 6508197 6508197 N_noFeature 1062271 29084300 1211678 N_ambiguous 239385 963 50081 UnstrandedReadsAssigned:28121715 PositiveStrandReadsAssigned:338108 NegativeStrandReadsAssigned:28161612 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322445 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322445-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,423,504 reads, 33,196,188 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR6322445.ke.tsv 35125 SRR6322445.se.tsv 88098 total ==> SRR6322445.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 122.555 5.368 PNS24249 1928 1829 307.33 6.95512 PNS24246 1044 945 122.555 5.368 PNS24248 1044 945 122.555 5.368 PNS24244 1471 1372 60.0062 1.81032 PNS24243 293 194 0 0 KQK14069 1603 1504 680.952 18.7406 KQK14071 474 375 218.904 24.1622 ==> SRR6322445.se.tsv <== BRADI_1g14170v3 1075 BRADI_1g53295v3 939 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 75 BRADI_1g74790v3 2 BRADI_1g09890v3 7 BRADI_1g77505v3 216 BRADI_1g48960v3 15 SRR6322445 completed mapping pipeline successfully