Starting /dee2/code/volunteer_pipeline.sh SRR6322447 current disk space = 1543381622784 free memory = 1601920860 SRR6322447 SRAfilesize 870f5e4d007b33818f6dd8f17823de28 SRR6322447.sra SRR6322447.sra file validated SRR6322447 is single end SRR6322447 is conventional basespace SRR6322447 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7235 34.0 33.0 34.0 31.0 34.0 2 32.599 34.0 34.0 34.0 31.0 34.0 3 33.124 34.0 34.0 34.0 31.0 34.0 4 36.59275 37.0 37.0 37.0 35.0 37.0 5 36.6605 37.0 37.0 37.0 35.0 37.0 6 36.66025 37.0 37.0 37.0 36.0 37.0 7 36.63125 37.0 37.0 37.0 35.0 37.0 8 36.66475 37.0 37.0 37.0 36.0 37.0 9 38.6085 39.0 39.0 39.0 38.0 39.0 10-14 38.865300000000005 39.4 39.2 39.4 38.0 39.4 15-19 39.99275 41.0 40.0 41.0 38.2 41.0 20-24 39.88895 41.0 40.0 41.0 38.0 41.0 25-29 39.49265 41.0 39.8 41.0 37.0 41.0 30-34 39.135400000000004 40.8 38.8 41.0 35.4 41.0 35-39 38.9246 41.0 38.6 41.0 35.0 41.0 40-44 38.3754 40.0 37.0 41.0 35.0 41.0 45-49 37.7405 40.0 35.0 41.0 33.6 41.0 50-54 36.88125 38.8 35.0 40.8 32.8 41.0 55-59 36.3868 37.2 35.0 41.0 32.2 41.0 60-64 35.94085 35.8 35.0 39.8 32.4 41.0 65-69 35.2932 35.0 35.0 38.8 31.8 41.0 70-74 34.66375000000001 35.0 35.0 36.8 31.8 39.4 75-79 33.7152 35.0 34.2 35.8 30.2 37.4 80-84 33.2591 35.0 34.0 35.0 30.0 36.4 85-89 32.88100000000001 35.0 34.0 35.0 29.2 35.6 90-94 32.53150000000001 35.0 33.4 35.0 28.6 35.0 95-99 32.16695 35.0 33.0 35.0 27.4 35.0 100-104 31.670250000000003 35.0 33.0 35.0 24.8 35.0 105-109 31.3405 35.0 32.8 35.0 24.0 35.0 110-114 30.585500000000003 34.8 31.4 35.0 20.0 35.0 115-119 30.01495 34.0 30.6 35.0 17.8 35.0 120-124 29.318399999999997 34.0 29.4 35.0 9.2 35.0 125-129 28.8091 34.0 29.0 35.0 3.6 35.0 130-134 28.045500000000004 33.8 27.4 35.0 2.0 35.0 135-139 26.953200000000002 33.0 25.0 35.0 2.0 35.0 140-144 26.0265 32.4 23.4 35.0 2.0 35.0 145-149 24.18315 31.8 8.6 34.2 2.0 35.0 150 17.4565 20.0 2.0 30.0 2.0 33.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 3.0 5 4.0 6 2.0 7 4.0 8 5.0 9 1.0 10 6.0 11 5.0 12 7.0 13 8.0 14 14.0 15 9.0 16 11.0 17 14.0 18 12.0 19 18.0 20 22.0 21 26.0 22 33.0 23 34.0 24 38.0 25 45.0 26 41.0 27 56.0 28 66.0 29 94.0 30 122.0 31 124.0 32 196.0 33 247.0 34 405.0 35 660.0 36 982.0 37 677.0 38 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.105263157894736 14.973684210526317 12.105263157894736 41.81578947368421 2 33.025 16.225 21.375 29.375 3 24.725 19.925 17.825 37.525 4 29.2 20.349999999999998 17.974999999999998 32.475 5 31.35 23.625 20.1 24.925 6 28.975 27.575 17.9 25.55 7 22.75 23.225 29.549999999999997 24.474999999999998 8 25.924999999999997 21.975 24.45 27.650000000000002 9 24.975 19.375 26.1 29.549999999999997 10-14 27.18 24.529999999999998 21.955 26.334999999999997 15-19 26.779999999999998 23.125 22.31 27.785 20-24 26.91 23.5 21.82 27.77 25-29 26.955000000000002 23.145 22.125 27.775 30-34 27.139999999999997 23.369999999999997 21.965 27.525 35-39 27.13 23.11 21.985 27.775 40-44 27.310000000000002 22.97 22.02 27.700000000000003 45-49 27.025 23.225 22.35 27.400000000000002 50-54 27.455000000000002 22.935 22.205 27.405 55-59 27.715 22.564999999999998 21.834999999999997 27.884999999999998 60-64 27.925 22.78 22.255 27.04 65-69 27.255000000000003 22.89 22.325 27.529999999999998 70-74 27.465 22.055 22.86 27.62 75-79 27.395000000000003 22.415 22.11 28.08 80-84 27.589999999999996 22.400000000000002 22.314999999999998 27.694999999999997 85-89 28.04 22.515 21.27 28.175 90-94 26.965 22.040000000000003 22.48 28.515 95-99 27.975 22.36 22.41 27.255000000000003 100-104 27.839999999999996 22.435 22.12 27.605 105-109 27.455000000000002 22.040000000000003 22.689999999999998 27.815 110-114 28.34 21.98 22.49 27.189999999999998 115-119 28.425 21.66 22.040000000000003 27.875 120-124 27.735 22.085 22.075 28.105000000000004 125-129 28.155 22.035 22.220000000000002 27.589999999999996 130-134 28.299999999999997 22.57 21.695 27.435 135-139 28.42 21.89 21.995 27.694999999999997 140-144 28.754999999999995 22.3 21.315 27.63 145-149 28.92 21.9 21.5 27.68 150 31.45 21.475 17.825 29.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 0.5 29 3.0 30 5.0 31 3.5 32 4.0 33 6.5 34 10.0 35 13.0 36 24.5 37 38.5 38 44.5 39 60.5 40 79.0 41 82.5 42 90.5 43 117.5 44 134.0 45 144.0 46 153.0 47 154.0 48 157.5 49 145.5 50 134.0 51 128.5 52 121.0 53 112.0 54 97.0 55 89.0 56 96.5 57 98.5 58 85.5 59 76.5 60 76.5 61 80.0 62 86.0 63 94.0 64 88.0 65 88.0 66 93.5 67 85.5 68 86.5 69 91.5 70 85.0 71 74.0 72 71.5 73 67.5 74 60.0 75 52.0 76 41.0 77 34.0 78 30.0 79 23.0 80 20.5 81 19.5 82 10.5 83 6.0 84 5.0 85 4.0 86 3.5 87 3.5 88 3.0 89 1.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.35 0.0 0.0 0.0 0.0 128-129 0.47500000000000003 0.0 0.0 0.0 0.0 130-131 0.6499999999999999 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.75 0.0 0.0 0.0 0.0 138 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635651 spots for SRR6322447.sra Written 2635651 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra Read 2635633 spots for SRR6322447.sra Written 2635633 spots for SRR6322447.sra SRR ids: ['SRR6322447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8jpk4og_ SRR6322447.sra spots: 52712678 blocks: [[1, 2635633], [2635634, 5271266], [5271267, 7906899], [7906900, 10542532], [10542533, 13178165], [13178166, 15813798], [15813799, 18449431], [18449432, 21085064], [21085065, 23720697], [23720698, 26356330], [26356331, 28991963], [28991964, 31627596], [31627597, 34263229], [34263230, 36898862], [36898863, 39534495], [39534496, 42170128], [42170129, 44805761], [44805762, 47441394], [47441395, 50077027], [50077028, 52712678]] SRR6322447 file size 19397624 SRR6322447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322447 SRR6322447_1.fastq Input file: SRR6322447_1.fastq trimmed: SRR6322447-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:03:43 2024 >> started Sat Dec 7 11:04:31 2024 >> done (48.071s) 52712678 reads processed; of these: 63136 ( 0.12%) short reads filtered out after trimming by size control 49657 ( 0.09%) empty reads filtered out after trimming by size control 52599885 (99.79%) reads available; of these: 27792805 (52.84%) trimmed reads available after processing 24807080 (47.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7310 0.01% 19 7794 0.01% 20 8528 0.02% 21 9162 0.02% 22 9382 0.02% 23 10404 0.02% 24 10994 0.02% 25 12255 0.02% 26 14558 0.03% 27 13580 0.03% 28 13964 0.03% 29 15038 0.03% 30 14713 0.03% 31 15578 0.03% 32 16007 0.03% 33 16510 0.03% 34 16832 0.03% 35 17111 0.03% 36 17298 0.03% 37 17968 0.03% 38 18187 0.03% 39 19416 0.04% 40 19111 0.04% 41 19884 0.04% 42 20549 0.04% 43 21186 0.04% 44 21444 0.04% 45 21654 0.04% 46 23170 0.04% 47 23989 0.05% 48 23943 0.05% 49 24160 0.05% 50 24610 0.05% 51 20895 0.04% 52 20700 0.04% 53 22288 0.04% 54 22300 0.04% 55 22816 0.04% 56 23146 0.04% 57 23712 0.05% 58 23270 0.04% 59 23571 0.04% 60 24146 0.05% 61 25705 0.05% 62 26691 0.05% 63 27510 0.05% 64 29046 0.06% 65 33499 0.06% 66 34680 0.07% 67 34336 0.07% 68 34876 0.07% 69 34966 0.07% 70 35576 0.07% 71 38693 0.07% 72 40543 0.08% 73 42009 0.08% 74 43030 0.08% 75 43444 0.08% 76 38568 0.07% 77 40596 0.08% 78 45533 0.09% 79 47552 0.09% 80 50622 0.10% 81 55153 0.10% 82 56991 0.11% 83 59183 0.11% 84 61629 0.12% 85 64623 0.12% 86 66592 0.13% 87 70318 0.13% 88 71209 0.14% 89 73545 0.14% 90 77199 0.15% 91 79840 0.15% 92 82501 0.16% 93 86407 0.16% 94 90973 0.17% 95 95504 0.18% 96 99818 0.19% 97 104556 0.20% 98 108435 0.21% 99 111973 0.21% 100 116949 0.22% 101 123192 0.23% 102 128446 0.24% 103 131394 0.25% 104 138080 0.26% 105 143652 0.27% 106 147867 0.28% 107 154700 0.29% 108 158708 0.30% 109 165921 0.32% 110 177040 0.34% 111 182884 0.35% 112 192875 0.37% 113 202469 0.38% 114 214938 0.41% 115 229858 0.44% 116 245761 0.47% 117 251599 0.48% 118 246925 0.47% 119 247711 0.47% 120 254628 0.48% 121 258865 0.49% 122 269860 0.51% 123 274454 0.52% 124 283075 0.54% 125 296547 0.56% 126 302597 0.58% 127 311222 0.59% 128 330391 0.63% 129 342051 0.65% 130 359290 0.68% 131 381050 0.72% 132 396159 0.75% 133 420353 0.80% 134 441093 0.84% 135 452720 0.86% 136 464828 0.88% 137 491659 0.93% 138 516043 0.98% 139 551291 1.05% 140 603383 1.15% 141 655489 1.25% 142 724584 1.38% 143 813987 1.55% 144 918193 1.75% 145 1068545 2.03% 146 1289608 2.45% 147 1537347 2.92% 148 1952329 3.71% 149 4193138 7.97% 150 24807080 47.16% 52599885 reads passed initial QC criterion=sequence-density sequence-density=1.20 sequence-density-rank=1 fanout-score=71.84 fanout-score-rank=9 prefix-density=1.83 prefix-fanout=47.3 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=351.50 fanout-score-rank=1 prefix-density=1.29 prefix-fanout=26.4 sequence=CGGCGGCGGCGA Started job on | Dec 07 11:04:51 Started mapping on | Dec 07 11:04:51 Finished on | Dec 07 11:06:11 Mapping speed, Million of reads per hour | 2366.99 Number of input reads | 52599885 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 50099387 Uniquely mapped reads % | 95.25% Average mapped length | 138.61 Number of splices: Total | 18809110 Number of splices: Annotated (sjdb) | 17758395 Number of splices: GT/AG | 18535459 Number of splices: GC/AG | 221315 Number of splices: AT/AC | 11306 Number of splices: Non-canonical | 41030 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 899132 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 1133422 % of reads mapped to too many loci | 2.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1601366 1601366 1601366 N_multimapping 899132 899132 899132 N_noFeature 1152215 25328056 25229851 N_ambiguous 788754 51156 53773 UnstrandedReadsAssigned:48158418 PositiveStrandReadsAssigned:24720175 NegativeStrandReadsAssigned:24815763 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR6322447 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322447-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,599,885 reads, 49,487,357 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR6322447.ke.tsv 35125 SRR6322447.se.tsv 88098 total ==> SRR6322447.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 13.4803 0.512171 PNS24247 1044 945 115.02 3.87066 PNS24249 1928 1829 1123.67 19.5374 PNS24246 1044 945 115.02 3.87066 PNS24248 1044 945 115.02 3.87066 PNS24244 1471 1372 84.7887 1.96529 PNS24243 293 194 29 4.75377 KQK14069 1603 1504 11871.2 251.008 KQK14071 474 375 2172.55 184.239 ==> SRR6322447.se.tsv <== BRADI_1g14170v3 14291 BRADI_1g53295v3 481 BRADI_1g59795v3 520 BRADI_1g07683v3 0 BRADI_1g00485v3 69 BRADI_1g20270v3 1241 BRADI_1g74790v3 1472 BRADI_1g09890v3 0 BRADI_1g77505v3 298 BRADI_1g48960v3 0 SRR6322447 completed mapping pipeline successfully