Starting /dee2/code/volunteer_pipeline.sh SRR6322448 current disk space = 1543276421120 free memory = 1602199868 SRR6322448 SRAfilesize fdca5db686951105d98fc386a5e1297f SRR6322448.sra SRR6322448.sra file validated SRR6322448 is single end SRR6322448 is conventional basespace SRR6322448 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47625 32.0 32.0 32.0 32.0 32.0 2 30.495 32.0 32.0 32.0 32.0 32.0 3 31.9375 32.0 32.0 37.0 27.0 37.0 4 36.0025 37.0 37.0 37.0 32.0 37.0 5 35.7775 37.0 37.0 37.0 32.0 37.0 6 40.11625 41.0 41.0 41.0 37.0 41.0 7 37.8915 41.0 37.0 41.0 32.0 41.0 8 39.98325 41.0 41.0 41.0 37.0 41.0 9 38.27825 41.0 37.0 41.0 32.0 41.0 10 40.25425 41.0 41.0 41.0 37.0 41.0 11 40.47825 41.0 41.0 41.0 41.0 41.0 12 40.201 41.0 41.0 41.0 37.0 41.0 13 39.563 41.0 41.0 41.0 37.0 41.0 14 37.9505 41.0 37.0 41.0 32.0 41.0 15 39.49925 41.0 41.0 41.0 37.0 41.0 16 39.351 41.0 41.0 41.0 37.0 41.0 17 40.156 41.0 41.0 41.0 37.0 41.0 18 39.7165 41.0 41.0 41.0 37.0 41.0 19 40.25325 41.0 41.0 41.0 37.0 41.0 20 40.03025 41.0 41.0 41.0 37.0 41.0 21 40.209 41.0 41.0 41.0 37.0 41.0 22 40.39425 41.0 41.0 41.0 41.0 41.0 23 39.71975 41.0 41.0 41.0 37.0 41.0 24 36.99375 41.0 37.0 41.0 27.0 41.0 25 37.248 41.0 37.0 41.0 27.0 41.0 26 37.151 41.0 37.0 41.0 27.0 41.0 27 39.22875 41.0 41.0 41.0 37.0 41.0 28 37.14925 41.0 37.0 41.0 27.0 41.0 29 37.2875 41.0 37.0 41.0 27.0 41.0 30 38.24 41.0 37.0 41.0 32.0 41.0 31 33.42225 37.0 27.0 41.0 12.0 41.0 32 33.77675 37.0 27.0 41.0 12.0 41.0 33 34.81325 41.0 32.0 41.0 22.0 41.0 34 30.34825 37.0 22.0 41.0 12.0 41.0 35 37.796 41.0 37.0 41.0 32.0 41.0 36 38.91375 41.0 37.0 41.0 37.0 41.0 37 33.27225 37.0 27.0 41.0 12.0 41.0 38 38.282 41.0 37.0 41.0 32.0 41.0 39 39.557 41.0 41.0 41.0 37.0 41.0 40 39.19575 41.0 41.0 41.0 37.0 41.0 41 38.96 41.0 41.0 41.0 37.0 41.0 42 39.559 41.0 41.0 41.0 37.0 41.0 43 39.063 41.0 41.0 41.0 37.0 41.0 44 39.83975 41.0 41.0 41.0 37.0 41.0 45 39.44975 41.0 41.0 41.0 37.0 41.0 46 38.59525 41.0 41.0 41.0 32.0 41.0 47 37.295 41.0 37.0 41.0 27.0 41.0 48 39.202 41.0 41.0 41.0 37.0 41.0 49 39.47725 41.0 41.0 41.0 37.0 41.0 50 37.9125 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 2.0 26 6.0 27 7.0 28 20.0 29 28.0 30 49.0 31 57.0 32 82.0 33 96.0 34 165.0 35 210.0 36 338.0 37 534.0 38 695.0 39 1012.0 40 695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.32016008004002 8.204102051025512 6.253126563281642 45.222611305652826 2 25.070785070785075 7.902187902187902 39.97425997425997 27.052767052767052 3 23.175 10.575 25.6 40.65 4 26.85 16.825000000000003 25.174999999999997 31.15 5 30.425 19.575 28.275 21.725 6 26.224999999999998 26.424999999999997 25.15 22.2 7 21.475 23.200000000000003 39.1 16.225 8 21.7 20.599999999999998 33.475 24.224999999999998 9 21.65 18.5 37.225 22.625 10 24.15 26.450000000000003 29.575000000000003 19.825 11 28.025 21.075 25.5 25.4 12 24.6 21.4 29.425 24.575 13 25.05 23.225 25.7 26.025 14 25.5 24.224999999999998 25.5 24.775 15 26.325 21.925 26.450000000000003 25.3 16 25.674999999999997 22.3 27.200000000000003 24.825 17 27.075 21.275 25.124999999999996 26.525 18 25.124999999999996 23.474999999999998 25.224999999999998 26.174999999999997 19 26.35 21.8 26.450000000000003 25.4 20 27.875 21.575 25.95 24.6 21 25.575 23.3 24.65 26.474999999999998 22 26.35 21.925 24.8 26.924999999999997 23 26.424999999999997 23.549999999999997 24.45 25.575 24 26.400000000000002 20.525 25.45 27.625 25 26.55 21.05 26.224999999999998 26.174999999999997 26 25.95 22.2 26.075 25.775 27 24.675 23.025000000000002 26.025 26.275 28 27.375 22.625 25.75 24.25 29 26.075 21.85 26.474999999999998 25.6 30 24.25 24.725 25.374999999999996 25.650000000000002 31 27.325 21.45 24.55 26.674999999999997 32 26.55 21.175 26.400000000000002 25.874999999999996 33 25.75 20.775 24.975 28.499999999999996 34 26.075 21.099999999999998 25.674999999999997 27.150000000000002 35 24.3 23.525 26.450000000000003 25.724999999999998 36 24.825 21.349999999999998 26.025 27.800000000000004 37 27.6 21.075 26.125 25.2 38 26.3 22.575 25.1 26.025 39 25.75 20.375 26.224999999999998 27.650000000000002 40 24.525 22.8 27.05 25.624999999999996 41 26.3 22.325 25.724999999999998 25.650000000000002 42 26.025 22.05 26.450000000000003 25.474999999999998 43 26.275 21.275 24.95 27.500000000000004 44 26.650000000000002 21.55 27.325 24.474999999999998 45 26.05 21.425 26.5 26.025 46 25.575 20.375 26.75 27.3 47 26.174999999999997 21.825 24.925 27.075 48 24.7 20.849999999999998 26.174999999999997 28.275 49 25.374999999999996 23.125 25.874999999999996 25.624999999999996 50 26.775 22.475 24.55 26.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.5 22 1.0 23 1.5 24 2.0 25 3.5 26 5.0 27 9.5 28 14.0 29 14.5 30 15.0 31 19.5 32 24.0 33 39.0 34 54.0 35 76.0 36 98.0 37 112.0 38 126.0 39 164.0 40 202.0 41 238.0 42 274.0 43 284.5 44 295.0 45 298.0 46 301.0 47 308.0 48 315.0 49 293.5 50 272.0 51 261.0 52 250.0 53 247.0 54 244.0 55 234.0 56 224.0 57 206.5 58 189.0 59 195.5 60 202.0 61 186.0 62 170.0 63 156.5 64 143.0 65 140.5 66 138.0 67 132.5 68 127.0 69 121.0 70 115.0 71 91.0 72 67.0 73 65.0 74 63.0 75 48.0 76 33.0 77 23.5 78 14.0 79 13.5 80 13.0 81 10.0 82 7.0 83 3.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 2.875 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.01455604075691 77.3 2 6.666666666666667 11.450000000000001 3 1.8631732168850075 4.8 4 0.727802037845706 2.5 5 0.37845705967976706 1.625 6 0.1455604075691412 0.75 7 0.029112081513828242 0.17500000000000002 8 0.058224163027656484 0.4 9 0.08733624454148471 0.675 >10 0.029112081513828242 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTCATCTTGTTGTTGATGTGGGCACGGCTGCTCCGGCTGAACCGACCA 13 0.325 No Hit GTATGATTAACAGCTGCCCTCGACGAAGAAGTCCATTGAACACATTGCGG 9 0.22499999999999998 No Hit GGTATGATTAACAGCTGCCCTCGACGAAGAAGTCCATTGAACACATTGCG 9 0.22499999999999998 No Hit CTTTATTTTTGTCACTGCTGCTACATCGACTAAAACAGCGGTGATCCCTA 9 0.22499999999999998 No Hit CTCATATATATTAGTTCATTCGCTCTGATGCCTTGCGACTTGAAGCCGAT 8 0.2 No Hit GGGATGATTAATAGTTGCCCCGAACGAAGAAGGCCATTGAACACATTTTG 8 0.2 No Hit CCTAATAGTTATCATACTAACTCATTCACTCCTGTGCCTTAGGGGTCGAA 7 0.17500000000000002 No Hit GCCTTAGGGGTCGAAGATGAATCCACGTCTCCGATCGGGTAACTCTGGCA 6 0.15 No Hit CTCGACGAAGAAGTCCATTGAACACATTGCGGCCTTGATTGTTAACAACC 6 0.15 No Hit CTCCTTTTGCCTAGGTTCAAGCTGGTTAGCATTATTGTTTACGTCAAAAA 6 0.15 No Hit GGGAAATTCTGACCGTTGAGGCGTGCGATACTGCCAGCACGTGGGTTGTA 6 0.15 No Hit CTCCTTGTGTAAACTGGTGGACTCTCTGGTGCACATCTCCCAACTTTTGG 6 0.15 No Hit CCCCTCTCTGGCAGCTAGCTTCACTCACTCACAGCACTCCGGTGGCCATC 5 0.125 No Hit GTCCATATTGTAGCACTCCGTTGTAGTTTCCGCCCAACAAAAACTCCTTT 5 0.125 No Hit CGGGAAATTCTGACCGTTGAGGCGTGCGATACTGCCAGCACGTGGGTTGT 5 0.125 No Hit GCCTCACTAAGCAACTGCACATTGAATCCACTAAATATGTTGTCACCGAA 5 0.125 No Hit GTTCGATTGGTAGGAAGGGTTGTTTCTGCTGTTGTTGGGTGACGACGGGC 5 0.125 No Hit GGGCATTAATGTTCCAGAATGGTGAAACAATCGCATTCTTCTGGAGATTT 5 0.125 No Hit CTTTATTTGTCACCGTTGCTACATCCACTAACCAACGGTGATCCATCTAT 5 0.125 No Hit CCCAGGAAAAGCCAGTCCTACAAAACCACTACCTTCGAGAATGTAGACTA 5 0.125 No Hit CTTGGATCACGTACACCACGCTATGGGCATTAATGTTCCAGAATGGTGAA 5 0.125 No Hit GTCCGAATGGCTGATCAGCGGCGGTGGCGCGGCAGTACGGTGGGAGGTAC 5 0.125 No Hit GTTAGCATTATTGTTTACGTCAAAAACATAGACTGCTACAACTGGCGCAT 5 0.125 No Hit CTCCAAACCATTCAAACTTCCACCAATTGATCGCCCAACCTGAGACCGCC 5 0.125 No Hit GTTGTATGTGTCGGCACGGTTGGGATCCTCGATGTTTTGCCTTGGCTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137742 READS because READLEN < 1 Read 2137742 spots for SRR6322448.sra Written 2137742 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra Rejected 2137724 READS because READLEN < 1 Read 2137724 spots for SRR6322448.sra Written 2137724 spots for SRR6322448.sra SRR ids: ['SRR6322448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kz_1z_pa SRR6322448.sra spots: 42754498 blocks: [[1, 2137724], [2137725, 4275448], [4275449, 6413172], [6413173, 8550896], [8550897, 10688620], [10688621, 12826344], [12826345, 14964068], [14964069, 17101792], [17101793, 19239516], [19239517, 21377240], [21377241, 23514964], [23514965, 25652688], [25652689, 27790412], [27790413, 29928136], [29928137, 32065860], [32065861, 34203584], [34203585, 36341308], [36341309, 38479032], [38479033, 40616756], [40616757, 42754498]] SRR6322448 file size 5990650 SRR6322448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322448 SRR6322448_1.fastq Input file: SRR6322448_1.fastq trimmed: SRR6322448-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:00:23 2024 >> started Sat Dec 7 11:00:46 2024 >> done (23.226s) 42754498 reads processed; of these: 157 ( 0.00%) short reads filtered out after trimming by size control 17198 ( 0.04%) empty reads filtered out after trimming by size control 42737143 (99.96%) reads available; of these: 32 ( 0.00%) trimmed reads available after processing 42737111 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 42737111 100.00% 42737143 reads passed initial QC criterion=sequence-density sequence-density=1.40 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=26 prefix-density=1.50 prefix-fanout=2.7 sequence=GGTCCCTGCGGCTGCGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=64.52 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.7 sequence=TTTATTTATATTTTATTGAGAACACAAACATCAAGTGCTGCACACTTGCGATTTATTTATTTTACTCTACAGTTCTCATATATATTAGTTCATTCGCTCTGATGCCTTGCGACTTGAAGCCGATTCCTCAAAACTCTGGTAGCTCAATGGAGGGAATTTAGTAGTGAAGGCGCCAAACTCTTCTCCCC Started job on | Dec 07 11:01:00 Started mapping on | Dec 07 11:01:00 Finished on | Dec 07 11:01:29 Mapping speed, Million of reads per hour | 5305.30 Number of input reads | 42737143 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 33365995 Uniquely mapped reads % | 78.07% Average mapped length | 49.80 Number of splices: Total | 3141101 Number of splices: Annotated (sjdb) | 2961482 Number of splices: GT/AG | 3023391 Number of splices: GC/AG | 36038 Number of splices: AT/AC | 1350 Number of splices: Non-canonical | 80322 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 8453761 % of reads mapped to multiple loci | 19.78% Number of reads mapped to too many loci | 727040 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.42% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 917387 917387 917387 N_multimapping 8453761 8453761 8453761 N_noFeature 1180538 32936567 1316927 N_ambiguous 376112 996 83907 UnstrandedReadsAssigned:31809345 PositiveStrandReadsAssigned:428432 NegativeStrandReadsAssigned:31965161 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322448 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322448-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,737,143 reads, 38,324,124 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR6322448.ke.tsv 35125 SRR6322448.se.tsv 88098 total ==> SRR6322448.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 122.926 5.19985 PNS24247 1044 945 44.23 1.65713 PNS24249 1928 1829 353.214 6.83749 PNS24246 1044 945 44.23 1.65713 PNS24248 1044 945 44.23 1.65713 PNS24244 1471 1372 80.1699 2.06885 PNS24243 293 194 0 0 KQK14069 1603 1504 1234.43 29.0596 KQK14071 474 375 200.969 18.9745 ==> SRR6322448.se.tsv <== BRADI_1g14170v3 1644 BRADI_1g53295v3 729 BRADI_1g59795v3 355 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 157 BRADI_1g74790v3 3 BRADI_1g09890v3 0 BRADI_1g77505v3 223 BRADI_1g48960v3 6 SRR6322448 completed mapping pipeline successfully