Starting /dee2/code/volunteer_pipeline.sh SRR6322449 current disk space = 1543244533760 free memory = 1596200388 SRR6322449 SRAfilesize 110f5776d7ca6ca8bdef7235d39452ec SRR6322449.sra SRR6322449.sra file validated SRR6322449 is single end SRR6322449 is conventional basespace SRR6322449 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322449_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.6625 32.0 32.0 32.0 27.0 32.0 2 31.18875 32.0 32.0 32.0 32.0 32.0 3 34.6775 37.0 32.0 37.0 32.0 37.0 4 35.645 37.0 37.0 37.0 32.0 37.0 5 36.60125 37.0 37.0 37.0 37.0 37.0 6 39.90275 41.0 41.0 41.0 37.0 41.0 7 39.56075 41.0 41.0 41.0 37.0 41.0 8 39.42325 41.0 41.0 41.0 37.0 41.0 9 39.918 41.0 41.0 41.0 37.0 41.0 10 40.38675 41.0 41.0 41.0 41.0 41.0 11 40.2105 41.0 41.0 41.0 37.0 41.0 12 40.369 41.0 41.0 41.0 41.0 41.0 13 40.29025 41.0 41.0 41.0 41.0 41.0 14 39.59675 41.0 41.0 41.0 37.0 41.0 15 39.601 41.0 41.0 41.0 37.0 41.0 16 39.18025 41.0 41.0 41.0 37.0 41.0 17 40.082 41.0 41.0 41.0 37.0 41.0 18 40.03 41.0 41.0 41.0 37.0 41.0 19 39.46425 41.0 41.0 41.0 37.0 41.0 20 39.25075 41.0 41.0 41.0 37.0 41.0 21 40.10025 41.0 41.0 41.0 37.0 41.0 22 39.739 41.0 41.0 41.0 37.0 41.0 23 39.55475 41.0 41.0 41.0 37.0 41.0 24 39.68625 41.0 41.0 41.0 37.0 41.0 25 40.1835 41.0 41.0 41.0 37.0 41.0 26 39.903 41.0 41.0 41.0 37.0 41.0 27 39.90125 41.0 41.0 41.0 37.0 41.0 28 38.5075 41.0 41.0 41.0 32.0 41.0 29 39.47775 41.0 41.0 41.0 37.0 41.0 30 39.63825 41.0 41.0 41.0 37.0 41.0 31 38.1455 41.0 41.0 41.0 32.0 41.0 32 39.016 41.0 41.0 41.0 37.0 41.0 33 38.07675 41.0 37.0 41.0 32.0 41.0 34 39.15 41.0 41.0 41.0 37.0 41.0 35 38.638 41.0 41.0 41.0 32.0 41.0 36 39.45025 41.0 41.0 41.0 37.0 41.0 37 38.60075 41.0 41.0 41.0 32.0 41.0 38 38.502 41.0 41.0 41.0 32.0 41.0 39 39.63025 41.0 41.0 41.0 37.0 41.0 40 39.94375 41.0 41.0 41.0 37.0 41.0 41 35.54225 41.0 37.0 41.0 12.0 41.0 42 38.22075 41.0 37.0 41.0 32.0 41.0 43 39.65175 41.0 41.0 41.0 37.0 41.0 44 38.6855 41.0 41.0 41.0 32.0 41.0 45 33.009 37.0 27.0 41.0 12.0 41.0 46 38.6185 41.0 37.0 41.0 32.0 41.0 47 37.17875 41.0 37.0 41.0 27.0 41.0 48 36.881 41.0 37.0 41.0 27.0 41.0 49 37.2835 41.0 37.0 41.0 27.0 41.0 50 38.203 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 1.0 25 4.0 26 4.0 27 12.0 28 17.0 29 30.0 30 58.0 31 64.0 32 50.0 33 82.0 34 131.0 35 165.0 36 205.0 37 231.0 38 423.0 39 842.0 40 1679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.266266266266264 9.80980980980981 6.006006006006006 42.91791791791792 2 22.93042153377349 10.15744032503809 37.48095479939055 29.43118334179787 3 21.7 12.2 24.55 41.55 4 28.825 18.35 19.825 33.0 5 28.325 25.0 23.75 22.925 6 23.95 29.175 24.175 22.7 7 19.725 24.5 37.95 17.825 8 21.3 22.275 32.300000000000004 24.125 9 19.1 21.349999999999998 34.425 25.124999999999996 10 20.150000000000002 32.65 27.474999999999998 19.725 11 24.85 26.275 23.875 25.0 12 23.549999999999997 21.425 27.0 28.025 13 21.775 24.175 28.349999999999998 25.7 14 22.525000000000002 25.35 28.275 23.849999999999998 15 21.75 24.625 27.025 26.6 16 23.825 23.425 26.950000000000003 25.8 17 23.125 26.375 26.325 24.175 18 22.650000000000002 25.974999999999998 24.95 26.424999999999997 19 24.025 24.175 25.874999999999996 25.924999999999997 20 23.225 24.0 26.625 26.150000000000002 21 23.3 24.625 25.95 26.125 22 23.225 25.025 26.450000000000003 25.3 23 23.599999999999998 24.775 25.2 26.424999999999997 24 21.95 24.95 26.05 27.05 25 24.85 23.775 25.2 26.174999999999997 26 24.0 24.85 26.200000000000003 24.95 27 22.175 25.2 26.8 25.825 28 23.9 23.974999999999998 25.8 26.325 29 23.775 26.05 26.1 24.075 30 22.775000000000002 23.5 26.125 27.6 31 23.45 24.625 25.575 26.35 32 23.150000000000002 26.1 26.474999999999998 24.275 33 23.474999999999998 24.0 26.875 25.650000000000002 34 24.775 24.175 25.124999999999996 25.924999999999997 35 22.525000000000002 24.775 27.650000000000002 25.05 36 22.375 24.125 26.55 26.950000000000003 37 24.6 25.174999999999997 23.375 26.85 38 23.3 25.650000000000002 26.200000000000003 24.85 39 23.625 24.099999999999998 23.275000000000002 28.999999999999996 40 23.45 25.75 25.4 25.4 41 24.8 24.725 26.375 24.099999999999998 42 23.799999999999997 24.25 26.275 25.674999999999997 43 24.85 23.799999999999997 24.875 26.474999999999998 44 22.675 25.6 26.775 24.95 45 23.849999999999998 24.6 27.05 24.5 46 24.95 24.675 23.150000000000002 27.224999999999998 47 24.4 23.425 26.700000000000003 25.474999999999998 48 23.025000000000002 22.55 26.5 27.925 49 23.825 23.5 25.4 27.275 50 22.975 25.35 25.775 25.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 2.0 24 4.0 25 8.5 26 13.0 27 15.0 28 17.0 29 26.0 30 35.0 31 55.5 32 76.0 33 82.5 34 89.0 35 109.0 36 129.0 37 156.0 38 183.0 39 208.0 40 233.0 41 262.0 42 291.0 43 316.0 44 341.0 45 339.0 46 337.0 47 335.0 48 333.0 49 308.0 50 283.0 51 266.0 52 249.0 53 240.0 54 231.0 55 216.5 56 202.0 57 176.0 58 150.0 59 147.0 60 144.0 61 133.0 62 122.0 63 113.0 64 104.0 65 102.5 66 101.0 67 90.5 68 80.0 69 78.0 70 76.0 71 65.0 72 54.0 73 50.0 74 46.0 75 39.5 76 33.0 77 24.0 78 15.0 79 13.0 80 11.0 81 9.5 82 8.0 83 6.0 84 4.0 85 3.0 86 2.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 1.55 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.14281991138911 92.225 2 3.466249674224655 6.65 3 0.3909304143862392 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657576 READS because READLEN < 1 Read 1657576 spots for SRR6322449.sra Written 1657576 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra Rejected 1657572 READS because READLEN < 1 Read 1657572 spots for SRR6322449.sra Written 1657572 spots for SRR6322449.sra SRR ids: ['SRR6322449.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7h4twfte SRR6322449.sra spots: 33151444 blocks: [[1, 1657572], [1657573, 3315144], [3315145, 4972716], [4972717, 6630288], [6630289, 8287860], [8287861, 9945432], [9945433, 11603004], [11603005, 13260576], [13260577, 14918148], [14918149, 16575720], [16575721, 18233292], [18233293, 19890864], [19890865, 21548436], [21548437, 23206008], [23206009, 24863580], [24863581, 26521152], [26521153, 28178724], [28178725, 29836296], [29836297, 31493868], [31493869, 33151444]] SRR6322449 file size 4640221 SRR6322449 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322449 SRR6322449_1.fastq Input file: SRR6322449_1.fastq trimmed: SRR6322449-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:06:15 2024 >> started Sat Dec 7 11:06:38 2024 >> done (23.832s) 33151444 reads processed; of these: 36 ( 0.00%) short reads filtered out after trimming by size control 31380 ( 0.09%) empty reads filtered out after trimming by size control 33120028 (99.91%) reads available; of these: 3578 ( 0.01%) trimmed reads available after processing 33116450 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3568 0.01% 50 33116450 99.99% 33120028 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=30 prefix-density=0.13 prefix-fanout=1.2 sequence=TTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=154.83 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.1 sequence=TCTTCTTCTTGTC Started job on | Dec 07 11:06:51 Started mapping on | Dec 07 11:06:51 Finished on | Dec 07 11:07:24 Mapping speed, Million of reads per hour | 3613.09 Number of input reads | 33120028 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 31648032 Uniquely mapped reads % | 95.56% Average mapped length | 49.80 Number of splices: Total | 4722668 Number of splices: Annotated (sjdb) | 4555625 Number of splices: GT/AG | 4655354 Number of splices: GC/AG | 58678 Number of splices: AT/AC | 2987 Number of splices: Non-canonical | 5649 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 957272 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 178770 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 514724 514724 514724 N_multimapping 957272 957272 957272 N_noFeature 1586329 30895629 1825378 N_ambiguous 570483 2463 57065 UnstrandedReadsAssigned:29491220 PositiveStrandReadsAssigned:749940 NegativeStrandReadsAssigned:29765589 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322449 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322449-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,120,028 reads, 29,518,154 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR6322449.ke.tsv 35125 SRR6322449.se.tsv 88098 total ==> SRR6322449.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 139.899 8.74675 PNS24249 1928 1829 484.397 15.6477 PNS24246 1044 945 139.899 8.74675 PNS24248 1044 945 139.899 8.74675 PNS24244 1471 1372 50.9047 2.19213 PNS24243 293 194 0 0 KQK14069 1603 1504 16685.7 655.482 KQK14071 474 375 3564.6 561.62 ==> SRR6322449.se.tsv <== BRADI_1g14170v3 22393 BRADI_1g53295v3 135 BRADI_1g59795v3 819 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 219 BRADI_1g74790v3 560 BRADI_1g09890v3 0 BRADI_1g77505v3 680 BRADI_1g48960v3 0 SRR6322449 completed mapping pipeline successfully