Starting /dee2/code/volunteer_pipeline.sh SRR6322450 current disk space = 1543148814336 free memory = 1603053500 SRR6322450 SRAfilesize 32b5645ee7174fdbd0528c438e885db5 SRR6322450.sra SRR6322450.sra file validated SRR6322450 is single end SRR6322450 is conventional basespace SRR6322450 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322450_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.78 32.0 32.0 32.0 27.0 32.0 2 31.17125 32.0 32.0 32.0 32.0 32.0 3 34.81125 37.0 32.0 37.0 32.0 37.0 4 35.6125 37.0 37.0 37.0 32.0 37.0 5 36.6425 37.0 37.0 37.0 37.0 37.0 6 40.0205 41.0 41.0 41.0 37.0 41.0 7 39.75725 41.0 41.0 41.0 37.0 41.0 8 39.5595 41.0 41.0 41.0 37.0 41.0 9 40.0205 41.0 41.0 41.0 37.0 41.0 10 40.4555 41.0 41.0 41.0 41.0 41.0 11 40.16775 41.0 41.0 41.0 37.0 41.0 12 40.39 41.0 41.0 41.0 41.0 41.0 13 40.23325 41.0 41.0 41.0 41.0 41.0 14 39.66 41.0 41.0 41.0 37.0 41.0 15 39.54375 41.0 41.0 41.0 37.0 41.0 16 39.08275 41.0 41.0 41.0 37.0 41.0 17 40.16525 41.0 41.0 41.0 37.0 41.0 18 39.99075 41.0 41.0 41.0 37.0 41.0 19 39.66625 41.0 41.0 41.0 37.0 41.0 20 39.2975 41.0 41.0 41.0 37.0 41.0 21 40.16225 41.0 41.0 41.0 37.0 41.0 22 39.6235 41.0 41.0 41.0 37.0 41.0 23 39.6865 41.0 41.0 41.0 37.0 41.0 24 39.696 41.0 41.0 41.0 37.0 41.0 25 40.18425 41.0 41.0 41.0 37.0 41.0 26 39.789 41.0 41.0 41.0 37.0 41.0 27 40.048 41.0 41.0 41.0 37.0 41.0 28 38.70975 41.0 41.0 41.0 32.0 41.0 29 39.63225 41.0 41.0 41.0 37.0 41.0 30 39.65825 41.0 41.0 41.0 37.0 41.0 31 38.12 41.0 41.0 41.0 32.0 41.0 32 39.152 41.0 41.0 41.0 37.0 41.0 33 38.09 41.0 41.0 41.0 32.0 41.0 34 39.196 41.0 41.0 41.0 37.0 41.0 35 38.741 41.0 41.0 41.0 32.0 41.0 36 39.50375 41.0 41.0 41.0 37.0 41.0 37 38.7935 41.0 41.0 41.0 37.0 41.0 38 38.72325 41.0 41.0 41.0 32.0 41.0 39 39.82575 41.0 41.0 41.0 37.0 41.0 40 39.9635 41.0 41.0 41.0 37.0 41.0 41 35.70875 41.0 37.0 41.0 12.0 41.0 42 38.4565 41.0 37.0 41.0 32.0 41.0 43 39.714 41.0 41.0 41.0 37.0 41.0 44 38.6995 41.0 41.0 41.0 32.0 41.0 45 33.37425 41.0 27.0 41.0 12.0 41.0 46 38.896 41.0 37.0 41.0 37.0 41.0 47 37.4505 41.0 37.0 41.0 27.0 41.0 48 37.4175 41.0 37.0 41.0 27.0 41.0 49 37.48075 41.0 37.0 41.0 27.0 41.0 50 38.345 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 5.0 27 11.0 28 19.0 29 30.0 30 41.0 31 47.0 32 62.0 33 101.0 34 118.0 35 135.0 36 204.0 37 244.0 38 396.0 39 828.0 40 1755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.225281602002504 10.913642052565708 6.007509386733417 42.85356695869837 2 22.123444246888493 11.836423672847346 41.02108204216409 25.019050038100076 3 20.3 16.475 24.85 38.375 4 24.575 21.725 23.35 30.349999999999998 5 26.275 27.775 24.375 21.575 6 21.9 30.9 24.85 22.35 7 18.9 23.974999999999998 38.425 18.7 8 18.975 23.549999999999997 31.374999999999996 26.1 9 18.325 19.85 36.65 25.174999999999997 10 22.625 31.674999999999997 26.5 19.2 11 25.85 24.075 22.775000000000002 27.3 12 23.75 21.7 27.450000000000003 27.1 13 24.675 25.424999999999997 25.674999999999997 24.224999999999998 14 22.85 24.9 26.375 25.874999999999996 15 22.900000000000002 23.65 26.25 27.200000000000003 16 23.75 24.875 24.9 26.474999999999998 17 24.625 24.7 24.875 25.8 18 23.200000000000003 23.599999999999998 26.724999999999998 26.474999999999998 19 26.150000000000002 23.3 24.45 26.1 20 23.525 24.775 26.35 25.35 21 21.925 26.0 24.975 27.1 22 24.375 26.325 23.525 25.775 23 23.799999999999997 26.8 24.875 24.525 24 23.125 25.15 25.0 26.724999999999998 25 24.0 24.175 24.5 27.325 26 22.2 26.125 26.400000000000002 25.275 27 22.725 26.3 25.3 25.674999999999997 28 25.324999999999996 25.4 23.075000000000003 26.200000000000003 29 24.05 25.3 24.675 25.974999999999998 30 23.125 24.275 26.025 26.575 31 24.325 25.874999999999996 24.224999999999998 25.575 32 23.724999999999998 25.4 25.874999999999996 25.0 33 23.075000000000003 24.825 24.6 27.500000000000004 34 23.225 25.6 24.4 26.775 35 24.125 25.1 25.874999999999996 24.9 36 24.4 23.9 24.875 26.825 37 24.8 24.65 24.15 26.400000000000002 38 22.575 24.525 26.700000000000003 26.200000000000003 39 23.075000000000003 24.099999999999998 25.55 27.275 40 23.799999999999997 25.174999999999997 24.099999999999998 26.924999999999997 41 23.75 25.85 25.775 24.625 42 23.65 25.324999999999996 24.6 26.424999999999997 43 25.35 25.2 24.675 24.775 44 23.05 25.525 26.0 25.424999999999997 45 23.599999999999998 24.55 26.424999999999997 25.424999999999997 46 24.2 24.125 24.925 26.75 47 24.425 23.95 25.874999999999996 25.75 48 23.724999999999998 25.074999999999996 24.575 26.625 49 25.35 25.124999999999996 24.575 24.95 50 22.775000000000002 27.150000000000002 25.1 24.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 4.0 24 6.0 25 7.0 26 8.0 27 18.5 28 29.0 29 38.5 30 48.0 31 53.0 32 58.0 33 75.0 34 92.0 35 117.0 36 142.0 37 164.0 38 186.0 39 218.0 40 250.0 41 262.0 42 274.0 43 313.0 44 352.0 45 331.5 46 311.0 47 306.5 48 302.0 49 299.5 50 297.0 51 275.5 52 254.0 53 234.0 54 214.0 55 190.5 56 167.0 57 160.5 58 154.0 59 152.0 60 150.0 61 155.0 62 160.0 63 136.5 64 113.0 65 114.0 66 115.0 67 100.5 68 86.0 69 81.0 70 76.0 71 66.5 72 57.0 73 47.5 74 38.0 75 29.5 76 21.0 77 17.5 78 14.0 79 12.5 80 11.0 81 9.0 82 7.0 83 4.5 84 2.0 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 1.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.46109810044237 92.675 2 3.1485818371064274 6.05 3 0.33827738745771535 0.975 4 0.026021337496747333 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026021337496747333 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 8 0.2 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604260 READS because READLEN < 1 Read 1604260 spots for SRR6322450.sra Written 1604260 spots for SRR6322450.sra Rejected 1604273 READS because READLEN < 1 Read 1604273 spots for SRR6322450.sra Written 1604273 spots for SRR6322450.sra SRR ids: ['SRR6322450.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qy4fn43o SRR6322450.sra spots: 32085213 blocks: [[1, 1604260], [1604261, 3208520], [3208521, 4812780], [4812781, 6417040], [6417041, 8021300], [8021301, 9625560], [9625561, 11229820], [11229821, 12834080], [12834081, 14438340], [14438341, 16042600], [16042601, 17646860], [17646861, 19251120], [19251121, 20855380], [20855381, 22459640], [22459641, 24063900], [24063901, 25668160], [25668161, 27272420], [27272421, 28876680], [28876681, 30480940], [30480941, 32085213]] SRR6322450 file size 4490282 SRR6322450 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322450 SRR6322450_1.fastq Input file: SRR6322450_1.fastq trimmed: SRR6322450-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:28:36 2024 >> started Sat Dec 7 12:28:59 2024 >> done (22.356s) 32085213 reads processed; of these: 84 ( 0.00%) short reads filtered out after trimming by size control 159198 ( 0.50%) empty reads filtered out after trimming by size control 31925931 (99.50%) reads available; of these: 3679 ( 0.01%) trimmed reads available after processing 31922252 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3672 0.01% 50 31922252 99.99% 31925931 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=5.23 fanout-score-rank=20 prefix-density=0.09 prefix-fanout=3.6 sequence=TCCTTGCCGTTCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=248.41 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=22.6 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:29:08 Started mapping on | Dec 07 12:29:08 Finished on | Dec 07 12:29:34 Mapping speed, Million of reads per hour | 4420.51 Number of input reads | 31925931 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 30740914 Uniquely mapped reads % | 96.29% Average mapped length | 49.82 Number of splices: Total | 4838580 Number of splices: Annotated (sjdb) | 4697988 Number of splices: GT/AG | 4761892 Number of splices: GC/AG | 68345 Number of splices: AT/AC | 3532 Number of splices: Non-canonical | 4811 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 829132 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 124853 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 355885 355885 355885 N_multimapping 829132 829132 829132 N_noFeature 1187347 30155531 1371868 N_ambiguous 431465 2282 32945 UnstrandedReadsAssigned:29122102 PositiveStrandReadsAssigned:583101 NegativeStrandReadsAssigned:29336101 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322450 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322450-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,925,931 reads, 29,075,146 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52973 SRR6322450.ke.tsv 35125 SRR6322450.se.tsv 88098 total ==> SRR6322450.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 47.0317 3.32685 PNS24247 1044 945 91.2227 5.7153 PNS24249 1928 1829 410.955 13.303 PNS24246 1044 945 91.2227 5.7153 PNS24248 1044 945 91.2227 5.7153 PNS24244 1471 1372 30.3455 1.30951 PNS24243 293 194 0 0 KQK14069 1603 1504 23881.5 940.116 KQK14071 474 375 4277.61 675.364 ==> SRR6322450.se.tsv <== BRADI_1g14170v3 30419 BRADI_1g53295v3 153 BRADI_1g59795v3 578 BRADI_1g07683v3 0 BRADI_1g00485v3 72 BRADI_1g20270v3 2761 BRADI_1g74790v3 324 BRADI_1g09890v3 0 BRADI_1g77505v3 471 BRADI_1g48960v3 0 SRR6322450 completed mapping pipeline successfully