Starting /dee2/code/volunteer_pipeline.sh SRR6789272 current disk space = 1543150841856 free memory = 1603036048 SRR6789272 SRAfilesize 167f916306cee4afa552fd6b51808df1 SRR6789272.sra SRR6789272.sra file validated SRR6789272 is paired end SRR6789272 is conventional basespace SRR6789272 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789272_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68975 33.0 33.0 34.0 32.0 34.0 2 32.716 34.0 33.0 34.0 32.0 34.0 3 32.7145 34.0 33.0 34.0 31.0 34.0 4 32.39875 34.0 33.0 34.0 31.0 34.0 5 32.39225 34.0 33.0 34.0 31.0 34.0 6 35.9315 38.0 36.0 38.0 31.0 38.0 7 36.59075 38.0 37.0 38.0 34.0 38.0 8 36.749 38.0 38.0 38.0 34.0 38.0 9 36.863 38.0 38.0 38.0 35.0 38.0 10-11 36.8695 38.0 38.0 38.0 35.0 38.0 12-13 36.892250000000004 38.0 38.0 38.0 35.0 38.0 14-15 36.898375 38.0 38.0 38.0 35.5 38.0 16-17 36.957 38.0 38.0 38.0 35.0 38.0 18-19 36.9075 38.0 38.0 38.0 35.0 38.0 20-21 36.90675 38.0 38.0 38.0 35.0 38.0 22-23 36.80825 38.0 38.0 38.0 35.0 38.0 24-25 36.74275 38.0 38.0 38.0 34.5 38.0 26-27 36.797875 38.0 38.0 38.0 34.5 38.0 28-29 36.755375 38.0 38.0 38.0 35.0 38.0 30-31 36.834 38.0 38.0 38.0 35.0 38.0 32-33 36.909375 38.0 38.0 38.0 35.0 38.0 34-35 36.829625 38.0 38.0 38.0 35.0 38.0 36-37 36.746625 38.0 38.0 38.0 34.5 38.0 38-39 36.4435 38.0 38.0 38.0 33.5 38.0 40-41 36.5065 38.0 38.0 38.0 34.0 38.0 42-43 36.46525 38.0 38.0 38.0 34.0 38.0 44-45 36.384625 38.0 38.0 38.0 33.5 38.0 46-47 36.3065 38.0 37.5 38.0 33.0 38.0 48-49 36.41975 38.0 38.0 38.0 34.0 38.0 50-51 36.345124999999996 38.0 38.0 38.0 33.0 38.0 52-53 36.228375 38.0 37.0 38.0 33.0 38.0 54-55 36.254125 38.0 37.5 38.0 33.0 38.0 56-57 36.26925 38.0 37.0 38.0 33.0 38.0 58-59 36.142875000000004 38.0 37.0 38.0 33.0 38.0 60-61 36.226 38.0 37.0 38.0 33.0 38.0 62-63 36.167 38.0 37.0 38.0 33.0 38.0 64-65 36.12075 38.0 37.0 38.0 32.0 38.0 66-67 36.116125 38.0 37.0 38.0 32.5 38.0 68-69 36.0005 38.0 37.0 38.0 32.0 38.0 70-71 36.023375 38.0 37.0 38.0 32.0 38.0 72-73 36.060625 38.0 37.0 38.0 32.0 38.0 74-75 35.949375 38.0 37.0 38.0 31.5 38.0 76-77 36.116749999999996 38.0 37.0 38.0 32.5 38.0 78-79 36.0345 38.0 37.0 38.0 32.0 38.0 80-81 36.06825 38.0 37.0 38.0 32.5 38.0 82-83 35.999375 38.0 37.0 38.0 32.0 38.0 84-85 35.8985 38.0 37.0 38.0 31.0 38.0 86-87 35.850624999999994 38.0 37.0 38.0 31.0 38.0 88-89 35.75087499999999 38.0 36.5 38.0 30.5 38.0 90-91 35.662 38.0 36.0 38.0 31.0 38.0 92-93 35.537625 38.0 36.0 38.0 29.0 38.0 94-95 35.535125 38.0 36.0 38.0 29.5 38.0 96-97 35.576375 38.0 36.0 38.0 30.0 38.0 98-99 35.61387499999999 38.0 36.0 38.0 31.0 38.0 100-101 35.51325 38.0 36.0 38.0 30.0 38.0 102-103 35.2495 38.0 36.0 38.0 28.5 38.0 104-105 35.227125 38.0 36.0 38.0 28.0 38.0 106-107 35.241375000000005 38.0 35.5 38.0 28.5 38.0 108-109 35.233374999999995 38.0 35.5 38.0 28.5 38.0 110-111 35.231125000000006 38.0 35.0 38.0 28.0 38.0 112-113 34.8965 38.0 35.0 38.0 27.0 38.0 114-115 34.9945 38.0 35.0 38.0 27.5 38.0 116-117 34.753375000000005 38.0 35.0 38.0 26.5 38.0 118-119 34.52275 38.0 35.0 38.0 24.5 38.0 120-121 34.773125 38.0 35.0 38.0 25.5 38.0 122-123 34.77375 38.0 35.0 38.0 26.0 38.0 124-125 34.8395 38.0 35.0 38.0 26.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 2.0 20 1.0 21 5.0 22 7.0 23 10.0 24 16.0 25 27.0 26 24.0 27 37.0 28 47.0 29 57.0 30 78.0 31 102.0 32 113.0 33 137.0 34 212.0 35 315.0 36 605.0 37 2204.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.074999999999996 16.625 8.799999999999999 36.5 2 24.45 18.975 32.725 23.849999999999998 3 20.5 23.7 25.8 30.0 4 26.775 27.224999999999998 22.425 23.575 5 24.565819280140953 32.92222501887742 22.426378051849987 20.08557764913164 6 21.5 31.900000000000002 23.674999999999997 22.925 7 17.625 20.525 39.900000000000006 21.95 8 20.275000000000002 20.349999999999998 27.85 31.525 9 20.225 20.875 30.975 27.925 10-11 25.724999999999998 27.425 20.9375 25.912499999999998 12-13 23.0375 23.474999999999998 26.387500000000003 27.1 14-15 23.0 24.587500000000002 26.2875 26.125 16-17 23.875 25.25 24.95 25.924999999999997 18-19 23.3125 25.7625 24.1875 26.737499999999997 20-21 23.165395674459308 25.328166020752597 25.19064883110389 26.31578947368421 22-23 24.2 25.525 25.087500000000002 25.1875 24-25 24.1375 25.1875 24.025 26.650000000000002 26-27 23.375 24.375 25.85 26.400000000000002 28-29 24.05 25.624999999999996 24.4125 25.912499999999998 30-31 23.8625 25.937500000000004 24.175 26.025 32-33 24.375 25.137500000000003 24.6875 25.8 34-35 24.034012754783042 24.934350381393024 25.28448168063024 25.747155183193698 36-37 24.75 24.2625 24.325 26.6625 38-39 24.4125 25.224999999999998 24.587500000000002 25.775 40-41 24.1875 24.5 24.925 26.387500000000003 42-43 24.01550193774222 25.690711338917367 24.353044130516317 25.9407425928241 44-45 24.3625 25.525 24.4 25.7125 46-47 23.4625 26.0125 25.2375 25.2875 48-49 23.8125 24.3 25.137500000000003 26.75 50-51 23.7875 26.0125 24.2375 25.9625 52-53 24.7375 24.9375 24.375 25.95 54-55 24.293573393348336 25.406351587896975 23.58089522380595 26.71917979494874 56-57 23.6125 25.0125 24.525 26.85 58-59 25.0375 24.462500000000002 24.462500000000002 26.0375 60-61 23.74640490183819 24.284106539952482 24.821808178066775 27.147680380142553 62-63 23.5875 25.4375 24.0125 26.9625 64-65 23.825 25.4 24.7875 25.9875 66-67 25.137500000000003 24.7 24.625 25.5375 68-69 24.325 25.224999999999998 24.775 25.674999999999997 70-71 25.1875 24.8625 24.5 25.45 72-73 23.875 25.162499999999998 24.6 26.3625 74-75 23.925 25.3 24.025 26.75 76-77 24.575 24.474999999999998 24.6625 26.2875 78-79 24.675 24.6625 23.95 26.7125 80-81 24.325 24.887500000000003 24.6 26.187500000000004 82-83 25.2875 25.162499999999998 23.8125 25.7375 84-85 25.162499999999998 24.525 23.6625 26.650000000000002 86-87 25.0125 24.775 24.6125 25.6 88-89 25.162499999999998 25.1875 24.3875 25.2625 90-91 25.0 25.637500000000003 23.575 25.7875 92-93 24.6125 25.5375 24.025 25.825 94-95 25.347005126922596 26.109791171689384 23.321245467050144 25.221958234337876 96-97 24.915572232645403 25.178236397748595 24.47779862414009 25.428392745465917 98-99 25.872202075778418 25.23446292359635 22.933600100037513 25.959734900587723 100-101 26.04127579737336 26.34146341463415 22.789243277048154 24.82801751094434 102-103 25.583730856138587 25.872457946271656 22.28219934722571 26.261611850364048 104-105 24.680851063829788 26.23279098873592 22.678347934918648 26.408010012515643 106-107 25.856892669502123 26.332249186890166 22.141606204653492 25.66925193895422 108-109 25.0625 26.8 22.650000000000002 25.4875 110-111 24.55 26.25 23.025000000000002 26.174999999999997 112-113 24.965430546825896 27.29101194217473 22.62727844123193 25.116279069767444 114-115 25.16015575932672 26.328350709709834 22.057530460997363 26.453963069966086 116-117 25.198938992042443 26.916761399520023 21.750663129973475 26.133636478464066 118-119 25.097693180385733 27.25324593470314 21.95890583637968 25.690155048531448 120-121 25.25025025025025 26.614114114114113 21.00850850850851 27.127127127127125 122-123 25.2875 27.075 21.675 25.9625 124-125 25.137500000000003 26.025 22.425 26.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 4.0 27 4.0 28 4.0 29 8.5 30 10.5 31 12.5 32 18.0 33 31.0 34 34.0 35 33.0 36 46.5 37 62.5 38 84.0 39 100.5 40 110.5 41 126.5 42 148.0 43 163.5 44 170.5 45 178.5 46 173.5 47 162.5 48 158.0 49 148.0 50 139.0 51 126.0 52 123.5 53 121.5 54 110.0 55 117.5 56 115.0 57 102.5 58 97.0 59 95.5 60 89.0 61 86.5 62 82.0 63 66.0 64 61.5 65 65.0 66 68.5 67 73.5 68 62.0 69 44.0 70 41.5 71 32.0 72 22.5 73 21.5 74 17.5 75 11.0 76 7.0 77 4.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.675 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0375 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0 58-59 0.0 60-61 0.0375 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0375 96-97 0.0625 98-99 0.0375 100-101 0.0625 102-103 0.42500000000000004 104-105 0.125 106-107 0.075 108-109 0.0 110-111 0.0 112-113 0.5625 114-115 0.4875 116-117 1.0375 118-119 0.8375 120-121 0.1 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5021579080985 97.0 2 1.4470677837014472 2.85 3 0.05077430820005078 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2375 0.0 0.0 0.0 0.0 64-65 0.2875 0.0 0.0 0.0 0.0 66-67 0.3375 0.0 0.0 0.0 0.0 68-69 0.42500000000000004 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.6375 0.0 0.0 0.0 0.0 74-75 0.875 0.0 0.0 0.0 0.0 76-77 1.1625 0.0 0.0 0.0 0.0 78-79 1.2875 0.0 0.0 0.0 0.0 80-81 1.625 0.0 0.0 0.0 0.0 82-83 1.8375 0.0 0.0 0.0 0.0 84-85 2.3 0.0 0.0 0.0 0.0 86-87 2.7874999999999996 0.0 0.0 0.0 0.0 88-89 3.3125 0.0 0.0 0.0 0.0 90-91 3.975 0.0 0.0 0.0 0.0 92-93 4.6875 0.0 0.0 0.0 0.0 94-95 5.95 0.0 0.0 0.0 0.0 96-97 7.0375 0.0 0.0 0.0 0.0 98-99 8.35 0.0 0.0 0.0 0.0 100-101 9.649999999999999 0.0 0.0 0.0 0.0 102-103 11.0375 0.0 0.0 0.0 0.0 104-105 12.575 0.0 0.0 0.0 0.0 106-107 14.325 0.0 0.0 0.0 0.0 108-109 15.9 0.0 0.0 0.0 0.0 110-111 17.4625 0.0 0.0 0.0 0.0 112-113 18.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6789272 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789272_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2205 33.0 33.0 34.0 31.0 34.0 2 32.2 33.0 33.0 34.0 31.0 34.0 3 32.2325 33.0 33.0 34.0 31.0 34.0 4 31.96475 33.0 33.0 34.0 30.0 34.0 5 32.10775 33.0 33.0 34.0 31.0 34.0 6 36.0765 38.0 38.0 38.0 33.0 38.0 7 36.2115 38.0 38.0 38.0 33.0 38.0 8 36.124 38.0 38.0 38.0 33.0 38.0 9 36.09 38.0 38.0 38.0 33.0 38.0 10-11 36.149375 38.0 38.0 38.0 33.0 38.0 12-13 36.02575 38.0 38.0 38.0 33.0 38.0 14-15 35.312 38.0 38.0 38.0 30.0 38.0 16-17 35.4255 38.0 38.0 38.0 29.0 38.0 18-19 35.675375 38.0 38.0 38.0 31.0 38.0 20-21 35.55 38.0 38.0 38.0 29.0 38.0 22-23 35.579625 38.0 37.5 38.0 28.5 38.0 24-25 35.941625 38.0 38.0 38.0 31.0 38.0 26-27 36.121624999999995 38.0 38.0 38.0 33.0 38.0 28-29 36.073875 38.0 38.0 38.0 32.5 38.0 30-31 36.054875 38.0 38.0 38.0 33.0 38.0 32-33 35.945125000000004 38.0 38.0 38.0 32.0 38.0 34-35 36.05575 38.0 38.0 38.0 33.0 38.0 36-37 36.076750000000004 38.0 38.0 38.0 33.0 38.0 38-39 36.132125 38.0 38.0 38.0 33.0 38.0 40-41 36.033500000000004 38.0 38.0 38.0 32.0 38.0 42-43 36.09587500000001 38.0 38.0 38.0 33.0 38.0 44-45 35.986125 38.0 37.5 38.0 32.0 38.0 46-47 35.79575 38.0 38.0 38.0 30.0 38.0 48-49 35.922375 38.0 38.0 38.0 32.0 38.0 50-51 35.877375 38.0 38.0 38.0 31.0 38.0 52-53 36.013374999999996 38.0 38.0 38.0 32.5 38.0 54-55 35.872749999999996 38.0 38.0 38.0 31.5 38.0 56-57 35.813500000000005 38.0 37.5 38.0 31.0 38.0 58-59 35.937124999999995 38.0 37.5 38.0 31.5 38.0 60-61 35.89625 38.0 37.5 38.0 31.0 38.0 62-63 35.842625 38.0 38.0 38.0 31.0 38.0 64-65 35.746375 38.0 37.0 38.0 30.5 38.0 66-67 35.886875 38.0 37.5 38.0 31.5 38.0 68-69 35.604125 38.0 37.0 38.0 29.0 38.0 70-71 35.656125 38.0 37.0 38.0 30.0 38.0 72-73 35.708875 38.0 37.0 38.0 30.0 38.0 74-75 35.610125 38.0 37.0 38.0 29.0 38.0 76-77 35.508750000000006 38.0 37.0 38.0 29.0 38.0 78-79 35.480125 38.0 37.0 38.0 29.0 38.0 80-81 35.485875 38.0 37.0 38.0 29.0 38.0 82-83 35.416375 38.0 37.0 38.0 28.5 38.0 84-85 35.350375 38.0 37.0 38.0 28.5 38.0 86-87 35.30925 38.0 36.5 38.0 28.5 38.0 88-89 35.262249999999995 38.0 37.0 38.0 28.0 38.0 90-91 35.07275 38.0 36.0 38.0 27.0 38.0 92-93 35.1135 38.0 36.0 38.0 27.0 38.0 94-95 34.9905 38.0 36.0 38.0 26.0 38.0 96-97 34.9065 38.0 36.0 38.0 26.0 38.0 98-99 35.0955 38.0 36.0 38.0 27.0 38.0 100-101 34.82625 38.0 36.0 38.0 24.5 38.0 102-103 34.94175 38.0 36.0 38.0 26.0 38.0 104-105 34.818375 38.0 35.0 38.0 25.0 38.0 106-107 34.766875 38.0 35.0 38.0 24.0 38.0 108-109 34.693875000000006 38.0 35.0 38.0 24.0 38.0 110-111 34.646625 38.0 35.0 38.0 23.5 38.0 112-113 34.539 38.0 35.0 38.0 23.0 38.0 114-115 34.512249999999995 38.0 34.5 38.0 23.5 38.0 116-117 34.33775 38.0 34.5 38.0 23.0 38.0 118-119 34.278125 38.0 34.5 38.0 23.0 38.0 120-121 34.065125 38.0 34.0 38.0 21.0 38.0 122-123 34.221374999999995 38.0 34.5 38.0 22.0 38.0 124-125 34.136875 38.0 34.0 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 6.0 17 12.0 18 15.0 19 18.0 20 14.0 21 14.0 22 20.0 23 22.0 24 45.0 25 27.0 26 28.0 27 43.0 28 55.0 29 56.0 30 78.0 31 82.0 32 108.0 33 141.0 34 207.0 35 278.0 36 489.0 37 2225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.36628198695434 19.11690918213748 9.60863020572002 30.90817862518816 2 28.6718553853879 21.79261862917399 29.927190559879485 19.608335425558625 3 22.596033140848608 25.633944263118252 27.190559879487825 24.579462716545315 4 25.735109323950738 32.57099773812516 19.55265141995476 22.14124151796934 5 27.039919658548833 33.818729600803415 18.629173989455182 20.51217675119257 6 24.090338770388957 32.747804265997495 18.77038895859473 24.391468005018822 7 22.60978670012547 16.23588456712673 35.58343789209536 25.57089084065245 8 22.478675363773206 20.02007024586051 25.11289513296538 32.3883592574009 9 24.567126725219573 21.63111668757842 24.993726474278542 28.80803011292346 10-11 28.70579382994733 25.532982192124404 20.040130423877603 25.721093554050668 12-13 25.922649140546007 21.73913043478261 24.064711830131447 28.273508594539937 14-15 25.32509334363332 23.870220162224797 25.41521823097721 25.389468263164673 16-17 27.24371249840419 23.809523809523807 23.75845780671518 25.188305885356826 18-19 26.361904761904764 23.75873015873016 23.339682539682542 26.53968253968254 20-21 26.713375796178347 23.961783439490446 23.961783439490446 25.363057324840767 22-23 26.368347870054354 24.573378839590443 24.2320819112628 24.826191379092403 24-25 26.65829145728643 23.919597989949747 23.80653266331658 25.615577889447238 26-27 26.46026573075959 24.90599147656054 24.05364753070945 24.58009526197042 28-29 26.53547254951116 24.617698671346204 24.028578591125598 24.818250188017046 30-31 25.745800952619703 23.990975181749814 24.843319127600903 25.41990473802958 32-33 26.372524442216093 25.620456254700425 23.564803208824266 24.442216094259212 34-35 26.58561042867887 24.354474805715718 24.417147154675355 24.642767610930058 36-37 26.32568634825122 25.00940203083866 24.081734988090762 24.583176632819356 38-39 26.10930057658561 24.40461268488343 24.27926798696415 25.206818751566807 40-41 26.827127992979815 24.558104550582925 24.05666290585433 24.558104550582925 42-43 26.63574830784658 24.968663825520178 23.740285785911254 24.655302080721984 44-45 26.115847542627886 24.511033099297894 24.611334002006018 24.761785356068206 46-47 26.536242789064456 24.266365688487586 24.52972159518435 24.667669927263606 48-49 26.836299824517422 24.066182000501378 24.40461268488343 24.69290549009777 50-51 26.385058912008024 24.216595638004513 24.17899222862873 25.219353221358737 52-53 26.67335171722236 24.166457758836803 24.818250188017046 24.34194033592379 54-55 26.207502195458538 24.55149918454397 24.538953707188558 24.702044912808933 56-57 26.29532053694643 24.890227073140135 23.97440722619496 24.84004516371848 58-59 26.71851480180632 24.234821876567988 24.00903161063723 25.03763171098846 60-61 26.342197691921726 24.197190165579528 25.200702458605118 24.25990968389363 62-63 26.521139129343872 24.162589386526157 24.852590641073892 24.46368084305608 64-65 26.88495797265086 24.438589888345252 24.47622632041149 24.200225818592397 66-67 26.492724535875567 24.96236828901154 24.096838936276967 24.448068238835926 68-69 26.18419399422038 25.128785023244127 24.400050257570047 24.28697072496545 70-71 26.10224846124859 24.155256877276724 25.813340032659216 23.929154628815475 72-73 25.552763819095475 24.736180904522616 24.43467336683417 25.27638190954774 74-75 26.586254554592287 24.24927754743058 25.003141098127905 24.161326799849228 76-77 26.045985676592537 24.689031285337354 25.02826988315115 24.23671315491896 78-79 26.55111780959558 23.97638784225069 24.880683245415725 24.591811102738006 80-81 26.036692636340792 23.66172405126916 24.66700175923599 25.634581553154057 82-83 26.652425232470474 25.282734355365672 24.50364413169138 23.56119628047248 84-85 26.4513696908771 24.18949484795175 24.69213370193516 24.66700175923599 86-87 26.652425232470474 26.237748177934154 23.335008796179945 23.77481779341543 88-89 26.300578034682083 24.541342045740137 24.69213370193516 24.465946217642625 90-91 27.180196029153052 25.295300326715253 24.541342045740137 22.983161598391554 92-93 26.991706458909277 25.094244785121887 24.47851218899221 23.435536566976626 94-95 26.731180092999875 25.486992585145156 23.865778559758702 23.916048762096267 96-97 26.72782106056798 25.6848454385524 24.114099019854233 23.473234481025386 98-99 27.73309876853481 25.11937672782106 23.8879115355617 23.259612968082433 100-101 27.61090863390725 25.87658665326128 24.029156717355786 22.48334799547568 102-103 28.34883136466449 24.981151042975622 24.302588590098015 22.367429002261872 104-105 26.803216888665492 26.514199547625033 23.498366423724555 23.18421713998492 106-107 28.39366515837104 25.414781297134237 24.044746103569633 22.146807440925087 108-109 28.616312680658538 26.052532361442754 23.312806334045494 22.018348623853214 110-111 29.10278964563961 26.187484292535814 23.686855993968333 21.022870067856246 112-113 29.89444584066348 25.33299824076401 22.932897712993213 21.83965820557929 114-115 28.901734104046245 25.58431766775572 23.850213621512943 21.663734606685097 116-117 30.24629303845187 25.835637094747423 22.56848454385524 21.349585322945465 118-119 29.404372958029658 25.923598894194523 23.93817542096004 20.733852726815783 120-121 30.953877089355288 25.80118134975493 22.94834736709815 20.29659419379163 122-123 30.824327720532796 26.099522493088717 22.354863030912288 20.7212867554662 124-125 31.414928373963306 26.036692636340792 22.731842171399848 19.816536818296054 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 5.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.5 23 2.5 24 1.5 25 1.5 26 1.5 27 2.0 28 3.5 29 6.0 30 6.0 31 9.0 32 13.5 33 16.5 34 24.5 35 35.0 36 57.0 37 70.0 38 74.5 39 88.0 40 101.0 41 121.5 42 147.5 43 153.0 44 156.0 45 157.0 46 158.5 47 158.5 48 147.0 49 139.5 50 135.5 51 127.5 52 120.5 53 123.5 54 119.5 55 118.0 56 120.0 57 111.0 58 100.5 59 95.0 60 86.0 61 92.0 62 95.5 63 89.0 64 80.5 65 67.5 66 67.0 67 73.0 68 66.5 69 50.0 70 47.5 71 42.0 72 30.5 73 26.5 74 20.5 75 13.0 76 6.5 77 3.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.42500000000000004 3 0.42500000000000004 4 0.525 5 0.42500000000000004 6 0.375 7 0.375 8 0.35000000000000003 9 0.375 10-11 0.325 12-13 1.0999999999999999 14-15 2.9125 16-17 2.0875 18-19 1.5625 20-21 1.875 22-23 1.1125 24-25 0.5 26-27 0.27499999999999997 28-29 0.27499999999999997 30-31 0.27499999999999997 32-33 0.27499999999999997 34-35 0.27499999999999997 36-37 0.2875 38-39 0.27499999999999997 40-41 0.2875 42-43 0.27499999999999997 44-45 0.3 46-47 0.325 48-49 0.27499999999999997 50-51 0.27499999999999997 52-53 0.27499999999999997 54-55 0.36250000000000004 56-57 0.36250000000000004 58-59 0.35000000000000003 60-61 0.35000000000000003 62-63 0.36250000000000004 64-65 0.36250000000000004 66-67 0.35000000000000003 68-69 0.5125000000000001 70-71 0.4875 72-73 0.5 74-75 0.5125000000000001 76-77 0.5125000000000001 78-79 0.475 80-81 0.525 82-83 0.525 84-85 0.525 86-87 0.525 88-89 0.525 90-91 0.525 92-93 0.525 94-95 0.5375 96-97 0.525 98-99 0.525 100-101 0.5375 102-103 0.525 104-105 0.525 106-107 0.5499999999999999 108-109 0.5375 110-111 0.525 112-113 0.525 114-115 0.525 116-117 0.525 118-119 0.525 120-121 0.5375 122-123 0.525 124-125 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85844748858447 97.425 2 1.0147133434804667 2.0 3 0.10147133434804667 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025367833587011668 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2625 0.0 0.0 0.0 0.0 64-65 0.3125 0.0 0.0 0.0 0.0 66-67 0.3625 0.0 0.0 0.0 0.0 68-69 0.44999999999999996 0.0 0.0 0.0 0.0 70-71 0.4875 0.0 0.0 0.0 0.0 72-73 0.625 0.0 0.0 0.0 0.0 74-75 0.825 0.0 0.0 0.0 0.0 76-77 1.125 0.0 0.0 0.0 0.0 78-79 1.3 0.0 0.0 0.0 0.0 80-81 1.675 0.0 0.0 0.0 0.0 82-83 1.9 0.0 0.0 0.0 0.0 84-85 2.3499999999999996 0.0 0.0 0.0 0.0 86-87 2.8125 0.0 0.0 0.0 0.0 88-89 3.2874999999999996 0.0 0.0 0.0 0.0 90-91 3.95 0.0 0.0 0.0 0.0 92-93 4.6625 0.0 0.0 0.0 0.0 94-95 5.8875 0.0 0.0 0.0 0.0 96-97 7.012499999999999 0.0 0.0 0.0 0.0 98-99 8.375 0.0 0.0 0.0 0.0 100-101 9.774999999999999 0.0 0.0 0.0 0.0 102-103 11.1375 0.0 0.0 0.0 0.0 104-105 12.6375 0.0 0.0 0.0 0.0 106-107 14.4125 0.0 0.0 0.0 0.0 108-109 15.9375 0.0 0.0 0.0 0.0 110-111 17.575 0.0 0.0 0.0 0.0 112-113 19.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782757 spots for SRR6789272.sra Written 1782757 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra Read 1782745 spots for SRR6789272.sra Written 1782745 spots for SRR6789272.sra SRR ids: ['SRR6789272.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vmlx4954 SRR6789272.sra spots: 35654912 blocks: [[1, 1782745], [1782746, 3565490], [3565491, 5348235], [5348236, 7130980], [7130981, 8913725], [8913726, 10696470], [10696471, 12479215], [12479216, 14261960], [14261961, 16044705], [16044706, 17827450], [17827451, 19610195], [19610196, 21392940], [21392941, 23175685], [23175686, 24958430], [24958431, 26741175], [26741176, 28523920], [28523921, 30306665], [30306666, 32089410], [32089411, 33872155], [33872156, 35654912]] SRR6789272 file size 11322677 SRR6789272 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789272 SRR6789272_1.fastq SRR6789272_2.fastq Input file: SRR6789272_1.fastq Paired file: SRR6789272_2.fastq trimmed: SRR6789272-trimmed-pair1.fastq, SRR6789272-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:34:08 2024 >> started Sat Dec 7 12:34:46 2024 >> done (37.405s) 35654912 read pairs processed; of these: 988 ( 0.00%) short read pairs filtered out after trimming by size control 165425 ( 0.46%) empty read pairs filtered out after trimming by size control 35488499 (99.53%) read pairs available; of these: 11769978 (33.17%) trimmed read pairs available after processing 23718521 (66.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 28 0.00% 20 17 0.00% 21 21 0.00% 22 15 0.00% 23 21 0.00% 24 23 0.00% 25 32 0.00% 26 23 0.00% 27 35 0.00% 28 46 0.00% 29 57 0.00% 30 80 0.00% 31 91 0.00% 32 111 0.00% 33 115 0.00% 34 152 0.00% 35 184 0.00% 36 227 0.00% 37 263 0.00% 38 343 0.00% 39 393 0.00% 40 463 0.00% 41 593 0.00% 42 628 0.00% 43 702 0.00% 44 809 0.00% 45 886 0.00% 46 1055 0.00% 47 1338 0.00% 48 1704 0.00% 49 1903 0.01% 50 2356 0.01% 51 2600 0.01% 52 2878 0.01% 53 3122 0.01% 54 3297 0.01% 55 3584 0.01% 56 3986 0.01% 57 4653 0.01% 58 5527 0.02% 59 6354 0.02% 60 7561 0.02% 61 8760 0.02% 62 9684 0.03% 63 10872 0.03% 64 12124 0.03% 65 12619 0.04% 66 13968 0.04% 67 15377 0.04% 68 16777 0.05% 69 19844 0.06% 70 23157 0.07% 71 26491 0.07% 72 30556 0.09% 73 34255 0.10% 74 36720 0.10% 75 40968 0.12% 76 42963 0.12% 77 46137 0.13% 78 50846 0.14% 79 57708 0.16% 80 65900 0.19% 81 77745 0.22% 82 82906 0.23% 83 91765 0.26% 84 99189 0.28% 85 105464 0.30% 86 111226 0.31% 87 119072 0.34% 88 133883 0.38% 89 137566 0.39% 90 144575 0.41% 91 162022 0.46% 92 174310 0.49% 93 191732 0.54% 94 203583 0.57% 95 213888 0.60% 96 234990 0.66% 97 224754 0.63% 98 227168 0.64% 99 237686 0.67% 100 246551 0.69% 101 263279 0.74% 102 280389 0.79% 103 295152 0.83% 104 307424 0.87% 105 312523 0.88% 106 315822 0.89% 107 312668 0.88% 108 315536 0.89% 109 314213 0.89% 110 316506 0.89% 111 324514 0.91% 112 341255 0.96% 113 351681 0.99% 114 362194 1.02% 115 365610 1.03% 116 360230 1.02% 117 349543 0.98% 118 339076 0.96% 119 335476 0.95% 120 336860 0.95% 121 339733 0.96% 122 344226 0.97% 123 361248 1.02% 124 370713 1.04% 125 23718521 66.83% 35488499 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=21 prefix-density=0.79 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=15.49 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.2 sequence=CTTGCAGGTGCTGCAGCCGCAGCCGCCGTTCTCCGCGGCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGCGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=39 prefix-density=0.85 prefix-fanout=1.0 sequence=TTCTCCATGTTCGG criterion=fanout-score sequence-density=0.28 sequence-density-rank=22 fanout-score=12.01 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=4.6 sequence=GAGAACCTCTTCGACCAC SRR6789272 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:35:44 Started mapping on | Dec 07 12:35:45 Finished on | Dec 07 12:37:52 Mapping speed, Million of reads per hour | 1005.97 Number of input reads | 35488499 Average input read length | 236 UNIQUE READS: Uniquely mapped reads number | 31271787 Uniquely mapped reads % | 88.12% Average mapped length | 235.99 Number of splices: Total | 21135050 Number of splices: Annotated (sjdb) | 19901204 Number of splices: GT/AG | 20842370 Number of splices: GC/AG | 249392 Number of splices: AT/AC | 6669 Number of splices: Non-canonical | 36619 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 1.70 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1970153 % of reads mapped to multiple loci | 5.55% Number of reads mapped to too many loci | 238613 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 2.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2273271 2273271 2273271 N_multimapping 1970153 1970153 1970153 N_noFeature 1579352 30014612 2134601 N_ambiguous 802768 3685 101023 UnstrandedReadsAssigned:28889667 PositiveStrandReadsAssigned:1253490 NegativeStrandReadsAssigned:29036163 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=111 echo kmer=107 SRR6789272 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789272-trimmed-pair1.fastq SRR6789272-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,488,499 reads, 29,824,188 reads pseudoaligned [quant] estimated average fragment length: 152.763 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,286 rounds 52973 SRR6789272.ke.tsv 35125 SRR6789272.se.tsv 88098 total ==> SRR6789272.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 784.328 1.56597 0.0896974 PNS24247 1044 892.237 64.0387 3.22447 PNS24249 1928 1776.24 101.312 2.56244 PNS24246 1044 892.237 64.0387 3.22447 PNS24248 1044 892.237 64.0387 3.22447 PNS24244 1471 1319.24 244.006 8.30947 PNS24243 293 146.96 0 0 KQK14069 1603 1451.24 26089 807.635 KQK14071 474 323.386 2353.86 327.007 ==> SRR6789272.se.tsv <== BRADI_1g14170v3 32613 BRADI_1g53295v3 48 BRADI_1g59795v3 1601 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 140 BRADI_1g74790v3 237 BRADI_1g09890v3 0 BRADI_1g77505v3 579 BRADI_1g48960v3 0 SRR6789272 completed mapping pipeline successfully