Starting /dee2/code/volunteer_pipeline.sh SRR6789273 current disk space = 1543149785088 free memory = 1603026276 SRR6789273 SRAfilesize 809ecf0ad38b8bb18b31108799f7aecd SRR6789273.sra SRR6789273.sra file validated SRR6789273 is paired end SRR6789273 is conventional basespace SRR6789273 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789273_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7225 34.0 33.0 34.0 32.0 34.0 2 32.68525 34.0 33.0 34.0 31.0 34.0 3 32.77475 34.0 33.0 34.0 31.0 34.0 4 32.455 34.0 33.0 34.0 31.0 34.0 5 32.35775 34.0 33.0 34.0 31.0 34.0 6 36.028 38.0 36.0 38.0 31.0 38.0 7 36.56825 38.0 37.0 38.0 34.0 38.0 8 36.79775 38.0 38.0 38.0 34.0 38.0 9 36.98275 38.0 38.0 38.0 35.0 38.0 10-11 36.990624999999994 38.0 38.0 38.0 35.5 38.0 12-13 37.064750000000004 38.0 38.0 38.0 36.0 38.0 14-15 37.026625 38.0 38.0 38.0 36.0 38.0 16-17 37.000875 38.0 38.0 38.0 35.0 38.0 18-19 37.017624999999995 38.0 38.0 38.0 36.0 38.0 20-21 36.944125 38.0 38.0 38.0 35.5 38.0 22-23 36.919875000000005 38.0 38.0 38.0 35.0 38.0 24-25 36.81575 38.0 38.0 38.0 35.0 38.0 26-27 36.878375000000005 38.0 38.0 38.0 35.0 38.0 28-29 36.875375000000005 38.0 38.0 38.0 35.0 38.0 30-31 36.957875 38.0 38.0 38.0 35.0 38.0 32-33 36.93025 38.0 38.0 38.0 35.0 38.0 34-35 36.903375 38.0 38.0 38.0 35.0 38.0 36-37 36.788 38.0 38.0 38.0 35.0 38.0 38-39 36.6375 38.0 38.0 38.0 34.0 38.0 40-41 36.6365 38.0 38.0 38.0 34.0 38.0 42-43 36.594875 38.0 38.0 38.0 34.0 38.0 44-45 36.4635 38.0 38.0 38.0 33.5 38.0 46-47 36.521 38.0 38.0 38.0 34.0 38.0 48-49 36.575374999999994 38.0 38.0 38.0 34.0 38.0 50-51 36.560625 38.0 38.0 38.0 34.0 38.0 52-53 36.498875 38.0 38.0 38.0 34.0 38.0 54-55 36.57675 38.0 38.0 38.0 34.0 38.0 56-57 36.457750000000004 38.0 38.0 38.0 33.5 38.0 58-59 36.433625000000006 38.0 38.0 38.0 34.0 38.0 60-61 36.427499999999995 38.0 37.5 38.0 33.5 38.0 62-63 36.370999999999995 38.0 38.0 38.0 33.5 38.0 64-65 36.276375 38.0 37.5 38.0 33.0 38.0 66-67 36.32225 38.0 37.5 38.0 33.0 38.0 68-69 36.192 38.0 37.5 38.0 32.5 38.0 70-71 36.115125000000006 38.0 37.0 38.0 32.5 38.0 72-73 36.243624999999994 38.0 37.5 38.0 33.0 38.0 74-75 36.09525 38.0 37.0 38.0 33.0 38.0 76-77 36.2355 38.0 37.0 38.0 33.0 38.0 78-79 36.163 38.0 37.0 38.0 33.0 38.0 80-81 36.12575 38.0 37.0 38.0 33.0 38.0 82-83 36.08225 38.0 37.0 38.0 32.0 38.0 84-85 36.047124999999994 38.0 37.0 38.0 32.5 38.0 86-87 36.013625000000005 38.0 37.0 38.0 32.5 38.0 88-89 35.974125 38.0 37.0 38.0 32.5 38.0 90-91 35.933375 38.0 37.0 38.0 32.0 38.0 92-93 35.741875 38.0 36.5 38.0 31.0 38.0 94-95 35.746624999999995 38.0 36.0 38.0 31.0 38.0 96-97 35.656125 38.0 36.0 38.0 31.0 38.0 98-99 35.726625 38.0 36.0 38.0 31.0 38.0 100-101 35.7465 38.0 36.0 38.0 31.0 38.0 102-103 35.43925 38.0 36.0 38.0 29.5 38.0 104-105 35.3605 38.0 36.0 38.0 29.0 38.0 106-107 35.38275 38.0 36.0 38.0 29.0 38.0 108-109 35.3715 38.0 36.0 38.0 29.0 38.0 110-111 35.621125 38.0 36.0 38.0 31.0 38.0 112-113 35.157250000000005 38.0 35.5 38.0 28.0 38.0 114-115 35.09075 38.0 35.0 38.0 28.0 38.0 116-117 34.827375 38.0 35.0 38.0 27.0 38.0 118-119 34.79 38.0 35.0 38.0 27.0 38.0 120-121 34.83 38.0 35.0 38.0 26.0 38.0 122-123 34.858375 38.0 35.0 38.0 26.5 38.0 124-125 34.966625 38.0 35.0 38.0 27.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 5.0 24 16.0 25 15.0 26 25.0 27 33.0 28 45.0 29 52.0 30 76.0 31 108.0 32 114.0 33 135.0 34 195.0 35 303.0 36 580.0 37 2294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.8 15.049999999999999 5.125 39.025 2 25.05 16.175 33.775 25.0 3 20.830207551887973 22.630657664416105 26.25656414103526 30.282570642660666 4 25.6 28.325 22.675 23.400000000000002 5 24.817150063051702 30.542244640605297 22.3203026481715 22.3203026481715 6 21.675 30.9 24.15 23.275000000000002 7 17.825 19.025 40.325 22.825 8 18.375 19.525000000000002 29.299999999999997 32.800000000000004 9 19.975 18.35 32.65 29.025000000000002 10-11 25.174999999999997 27.3375 19.537499999999998 27.950000000000003 12-13 24.025 20.349999999999998 26.5875 29.037499999999998 14-15 22.1375 23.4625 26.775 27.625 16-17 23.549999999999997 22.6 25.55 28.299999999999997 18-19 24.25 23.3625 24.474999999999998 27.9125 20-21 24.65 23.375 25.474999999999998 26.5 22-23 24.575 22.9375 25.7125 26.775 24-25 23.1 23.549999999999997 25.525 27.825 26-27 23.3875 22.5625 25.674999999999997 28.375 28-29 24.25 23.775 25.2 26.775 30-31 23.825 22.3875 25.8625 27.925 32-33 24.65 23.0 25.0625 27.287499999999998 34-35 25.137500000000003 23.5875 24.55 26.724999999999998 36-37 24.65 24.125 24.85 26.375 38-39 24.337500000000002 23.4625 24.7875 27.4125 40-41 24.975 22.112499999999997 24.425 28.487499999999997 42-43 24.6625 23.45 24.6875 27.200000000000003 44-45 24.0375 23.4125 25.1875 27.3625 46-47 23.3375 23.125 25.8 27.737499999999997 48-49 23.125 23.400000000000002 24.762500000000003 28.712500000000002 50-51 24.0 23.4625 24.925 27.6125 52-53 23.400000000000002 22.9875 25.324999999999996 28.287499999999998 54-55 24.462500000000002 23.7 23.962500000000002 27.875 56-57 23.25 23.25 25.912499999999998 27.5875 58-59 23.962500000000002 23.400000000000002 25.974999999999998 26.6625 60-61 25.124999999999996 22.8 25.362499999999997 26.7125 62-63 23.825 22.0625 25.8125 28.299999999999997 64-65 24.15 23.2125 25.2375 27.400000000000002 66-67 22.975 24.2625 25.15 27.6125 68-69 24.6125 23.0125 25.087500000000002 27.287499999999998 70-71 24.712500000000002 22.975 25.137500000000003 27.175 72-73 24.975 23.0625 24.3625 27.6 74-75 24.65 23.3125 24.675 27.3625 76-77 24.3625 23.45 24.725 27.462500000000002 78-79 24.3625 23.799999999999997 24.4125 27.425 80-81 24.0125 23.5875 25.587500000000002 26.8125 82-83 24.5375 23.9375 24.8 26.724999999999998 84-85 25.0 23.35 23.6625 27.987499999999997 86-87 25.387500000000003 23.8875 23.6125 27.1125 88-89 24.675 24.425 23.825 27.075 90-91 25.424999999999997 23.4125 24.087500000000002 27.075 92-93 25.3125 24.2625 23.05 27.375 94-95 25.387500000000003 24.8 23.3625 26.450000000000003 96-97 24.8125 24.6125 23.1 27.474999999999998 98-99 24.625 24.575 24.212500000000002 26.5875 100-101 24.6125 23.974999999999998 24.5375 26.875 102-103 25.056518462697813 24.755086661642803 22.645064054257723 27.543330821401657 104-105 25.162581290645324 25.18759379689845 22.973986993496748 26.675837918959477 106-107 24.959359759909965 24.84681755658372 23.35875953482556 26.835063148680753 108-109 25.637500000000003 24.9 22.7375 26.724999999999998 110-111 25.137500000000003 25.7 22.125 27.037499999999998 112-113 24.70455116922303 25.86120191098818 22.25295448830777 27.181292431481012 114-115 25.600100540404675 25.160236269950985 22.4582128943069 26.78145029533744 116-117 24.601769911504427 25.663716814159294 22.25031605562579 27.48419721871049 118-119 25.71608832807571 26.359621451104097 21.425867507886434 26.498422712933756 120-121 25.284624046040282 25.70999624671588 21.719004128612536 27.2863755786313 122-123 24.45 25.587500000000002 22.525000000000002 27.437499999999996 124-125 24.1375 26.737499999999997 21.45 27.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 1.5 28 2.0 29 3.5 30 5.5 31 9.0 32 12.0 33 12.0 34 18.5 35 27.5 36 35.0 37 48.5 38 57.5 39 68.5 40 83.0 41 87.5 42 97.5 43 121.5 44 118.5 45 108.0 46 129.0 47 147.5 48 149.5 49 141.0 50 152.5 51 160.0 52 160.0 53 175.5 54 191.5 55 218.5 56 216.5 57 181.5 58 161.5 59 136.0 60 109.0 61 102.5 62 88.5 63 67.5 64 54.5 65 52.5 66 51.5 67 51.5 68 47.0 69 33.0 70 24.0 71 21.0 72 18.5 73 15.0 74 9.0 75 6.0 76 4.0 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.8750000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.475 104-105 0.05 106-107 0.0375 108-109 0.0 110-111 0.0 112-113 0.575 114-115 0.5375 116-117 1.125 118-119 0.9375 120-121 0.08750000000000001 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.75 #Duplication Level Percentage of deduplicated Percentage of total 1 90.94017094017094 79.80000000000001 2 6.296296296296296 11.05 3 1.6524216524216526 4.35 4 0.5982905982905984 2.1 5 0.19943019943019943 0.8750000000000001 6 0.17094017094017094 0.8999999999999999 7 0.11396011396011395 0.7000000000000001 8 0.0 0.0 9 0.028490028490028487 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 9 0.22499999999999998 No Hit GGGATACTTAACGCGTTAGCTACAGCACTGCACGGGTCGAGTCGCACAGC 7 0.17500000000000002 No Hit GTCGGTTCGGACCTCTGCTTAGTTTCATCCAAGCTTCATCCTGGTCATGG 7 0.17500000000000002 No Hit GTTTACGGCTAGGACTACTGGGGTCTCTAATCCCATTTGCTCCCCTAGCT 7 0.17500000000000002 No Hit GTTCTATTTCACTACCCACTGGGGGTTCTTTTCACCTTTCCCTCACGGTA 7 0.17500000000000002 No Hit GGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTA 6 0.15 No Hit CTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCGCC 6 0.15 No Hit CCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAAACCTTGGGTTTTC 6 0.15 No Hit GTAAAGGCTCCCACTTATCCTACACCTCTCAAGTCATTTCACAAAGTCGG 6 0.15 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTC 6 0.15 No Hit GTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCT 6 0.15 No Hit GTTAGCTACAGCACTGCACGGGTCGAGTCGCACAGCACCTAGTATCCATC 5 0.125 No Hit GGAGTATTTAGCCTTGCAAGGTGGTCCTTGCTGATTCACACGGGATTCCA 5 0.125 No Hit CCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAAACCTTGGGTTTT 5 0.125 No Hit CCTACCGATGCATTTTGACATCCCACAGCTTCGGCAGATCGCTTAGCCCC 5 0.125 No Hit CTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACAC 5 0.125 No Hit ACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATT 5 0.125 No Hit GCCAGGTTGTCTCTTGCCTGCTCATGGATTCAGCAGGCAGTTTAAAAGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.07500000000000001 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.1875 0.0 0.0 0.0 0.0 56-57 0.2375 0.0 0.0 0.0 0.0 58-59 0.3125 0.0 0.0 0.0 0.0 60-61 0.3875 0.0 0.0 0.0 0.0 62-63 0.4375 0.0 0.0 0.0 0.0 64-65 0.5375 0.0 0.0 0.0 0.0 66-67 0.6875 0.0 0.0 0.0 0.0 68-69 0.75 0.0 0.0 0.0 0.0 70-71 0.9125 0.0 0.0 0.0 0.0 72-73 1.0875 0.0 0.0 0.0 0.0 74-75 1.425 0.0 0.0 0.0 0.0 76-77 1.7374999999999998 0.0 0.0 0.0 0.0 78-79 2.25 0.0 0.0 0.0 0.0 80-81 2.7625 0.0 0.0 0.0 0.0 82-83 3.5125 0.0 0.0 0.0 0.0 84-85 4.1875 0.0 0.0 0.0 0.0 86-87 4.9 0.0 0.0 0.0 0.0 88-89 5.762499999999999 0.0 0.0 0.0 0.0 90-91 6.7 0.0 0.0 0.0 0.0 92-93 8.0125 0.0 0.0 0.0 0.0 94-95 9.125 0.0 0.0 0.0 0.0 96-97 10.65 0.0 0.0 0.0 0.0 98-99 12.2125 0.0 0.0 0.0 0.0 100-101 13.462499999999999 0.0 0.0 0.0 0.0 102-103 15.162500000000001 0.0 0.0 0.0 0.0 104-105 16.95 0.0 0.0 0.0 0.0 106-107 18.6875 0.0 0.0 0.0 0.0 108-109 20.799999999999997 0.0 0.0 0.0 0.0 110-111 23.0 0.0 0.0 0.0 0.0 112-113 25.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6789273 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789273_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1305 33.0 33.0 34.0 31.0 34.0 2 32.1555 33.0 33.0 34.0 31.0 34.0 3 32.199 33.0 33.0 34.0 31.0 34.0 4 31.97975 33.0 33.0 34.0 30.0 34.0 5 32.04725 33.0 33.0 34.0 31.0 34.0 6 36.08375 38.0 38.0 38.0 33.0 38.0 7 36.25175 38.0 38.0 38.0 33.0 38.0 8 36.14275 38.0 38.0 38.0 33.0 38.0 9 36.18225 38.0 38.0 38.0 33.0 38.0 10-11 36.182625 38.0 38.0 38.0 33.0 38.0 12-13 35.811 38.0 38.0 38.0 32.5 38.0 14-15 35.034125 38.0 38.0 38.0 28.5 38.0 16-17 35.249375 38.0 38.0 38.0 28.5 38.0 18-19 35.46225 38.0 38.0 38.0 29.0 38.0 20-21 35.354375 38.0 38.0 38.0 29.0 38.0 22-23 35.48325 38.0 37.5 38.0 28.5 38.0 24-25 35.88475 38.0 37.5 38.0 30.0 38.0 26-27 36.114 38.0 38.0 38.0 33.0 38.0 28-29 36.176625 38.0 38.0 38.0 33.0 38.0 30-31 36.28275 38.0 38.0 38.0 33.5 38.0 32-33 36.127125 38.0 38.0 38.0 33.0 38.0 34-35 36.200125 38.0 38.0 38.0 33.0 38.0 36-37 36.071 38.0 38.0 38.0 33.0 38.0 38-39 36.0775 38.0 38.0 38.0 33.0 38.0 40-41 36.115375 38.0 38.0 38.0 33.0 38.0 42-43 36.0935 38.0 38.0 38.0 33.0 38.0 44-45 35.963125000000005 38.0 37.5 38.0 32.0 38.0 46-47 35.94675 38.0 38.0 38.0 31.5 38.0 48-49 35.983625 38.0 38.0 38.0 32.0 38.0 50-51 35.96425 38.0 38.0 38.0 32.0 38.0 52-53 36.02725 38.0 38.0 38.0 32.5 38.0 54-55 36.040875 38.0 38.0 38.0 33.0 38.0 56-57 35.939 38.0 38.0 38.0 32.0 38.0 58-59 35.8945 38.0 38.0 38.0 31.5 38.0 60-61 35.846374999999995 38.0 38.0 38.0 31.0 38.0 62-63 35.822125 38.0 38.0 38.0 31.5 38.0 64-65 35.7975 38.0 37.0 38.0 31.0 38.0 66-67 35.861125 38.0 38.0 38.0 31.5 38.0 68-69 35.56375 38.0 37.0 38.0 29.0 38.0 70-71 35.670125 38.0 37.0 38.0 31.0 38.0 72-73 35.58575 38.0 37.0 38.0 30.0 38.0 74-75 35.595 38.0 37.0 38.0 29.0 38.0 76-77 35.563625 38.0 37.0 38.0 29.0 38.0 78-79 35.508250000000004 38.0 37.0 38.0 29.0 38.0 80-81 35.554249999999996 38.0 37.0 38.0 29.0 38.0 82-83 35.492000000000004 38.0 37.0 38.0 29.0 38.0 84-85 35.312625 38.0 37.0 38.0 28.5 38.0 86-87 35.478875 38.0 37.0 38.0 30.0 38.0 88-89 35.48075 38.0 37.0 38.0 30.0 38.0 90-91 35.306250000000006 38.0 36.5 38.0 28.5 38.0 92-93 35.185125 38.0 36.0 38.0 28.0 38.0 94-95 35.1495 38.0 36.0 38.0 28.0 38.0 96-97 34.97925 38.0 36.0 38.0 27.0 38.0 98-99 35.036249999999995 38.0 36.0 38.0 27.0 38.0 100-101 34.883250000000004 38.0 35.5 38.0 26.5 38.0 102-103 34.924875 38.0 35.5 38.0 27.0 38.0 104-105 34.768 38.0 35.5 38.0 25.0 38.0 106-107 34.742875 38.0 35.0 38.0 25.0 38.0 108-109 34.6155 38.0 35.0 38.0 24.0 38.0 110-111 34.607 38.0 35.0 38.0 23.5 38.0 112-113 34.50625 38.0 35.0 38.0 23.5 38.0 114-115 34.323625 38.0 34.5 38.0 22.5 38.0 116-117 34.141375 38.0 34.0 38.0 23.0 38.0 118-119 34.146874999999994 38.0 34.0 38.0 23.0 38.0 120-121 33.858875 38.0 34.0 38.0 21.0 38.0 122-123 33.97725 38.0 34.0 38.0 22.0 38.0 124-125 33.902625 38.0 34.0 38.0 21.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 5.0 18 6.0 19 11.0 20 8.0 21 16.0 22 13.0 23 21.0 24 27.0 25 42.0 26 28.0 27 43.0 28 57.0 29 63.0 30 87.0 31 97.0 32 116.0 33 135.0 34 217.0 35 308.0 36 510.0 37 2160.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.90387518872672 19.703069954705587 6.492199295420232 30.900855561147463 2 31.678427419354836 21.068548387096776 27.872983870967744 19.380040322580644 3 23.61391129032258 25.78125 26.814516129032256 23.790322580645164 4 27.28877679697352 33.3921815889029 19.34426229508197 19.974779319041613 5 30.34274193548387 34.551411290322584 17.1875 17.918346774193548 6 24.98111306975573 33.41727524553009 18.635104507680687 22.966507177033492 7 22.149509187012335 18.07198590485779 34.40724893027939 25.371255977850492 8 23.729240060392552 22.14393558127831 22.84851534977353 31.27830900855561 9 25.666834423754402 21.766482133870156 25.037745344740813 27.528938097634626 10-11 29.097999748396024 26.632280790036482 18.36709020002516 25.90262926154233 12-13 27.42857142857143 21.32063492063492 23.174603174603174 28.076190476190476 14-15 26.865089680270344 25.110475695347024 23.394853132310892 24.629581492071743 16-17 28.858024691358025 23.881172839506174 22.183641975308642 25.07716049382716 18-19 28.32118654903465 25.226953075054343 22.644163150492265 23.807697225418746 20-21 29.263913824057454 23.980507822518597 22.1082328802257 24.647345473198257 22-23 27.58576874205845 24.20584498094028 24.104193138500634 24.104193138500634 24-25 28.247448658183195 24.80786191256142 22.1116290789971 24.833060350258286 26-27 28.343388637506283 24.33383609854198 22.473604826546005 24.849170437405732 28-29 26.926461345065995 25.065996228786926 23.469516027655562 24.538026398491514 30-31 28.734909456740443 24.798792756539235 22.761569416498993 23.70472837022133 32-33 27.705845380263984 24.802011313639223 22.489000628535514 25.00314267756128 34-35 28.11714429361488 25.289089994972347 22.80040221216692 23.79336349924585 36-37 28.42594920794569 25.056575308021124 21.800352024138796 24.717123459894395 38-39 29.07605279698303 24.839723444374606 23.104965430546827 22.979258328095536 40-41 27.534591194968556 25.710691823899374 22.67924528301887 24.07547169811321 42-43 27.024647887323944 24.72334004024145 23.377766599597585 24.87424547283702 44-45 28.06841046277666 24.962273641851105 21.81841046277666 25.15090543259557 46-47 28.141904642093348 25.374260913322434 22.505975594414394 23.977858850169834 48-49 28.080985915492956 25.012575452716295 22.459758551307846 24.446680080482896 50-51 27.727501256913023 25.666163901458017 22.812971342383108 23.79336349924585 52-53 27.300150829562593 25.50276520864756 23.102061337355455 24.09502262443439 54-55 28.0483201208003 24.39914433119416 23.09047439285265 24.462061155152888 56-57 27.579265223955712 25.465525918470057 23.465022647206844 23.49018621036739 58-59 27.47861097131354 24.949672873678914 22.986914947156517 24.584801207851033 60-61 28.47257171615501 24.962254655259184 22.596879718168093 23.968293910417714 62-63 28.195772521389028 24.13185707096125 23.301459486663312 24.37091092098641 64-65 27.7176648213387 26.094614997483646 22.50880724710619 23.678912934071462 66-67 28.082536487166582 25.36487166582788 22.06844489179668 24.484146955208857 68-69 27.155824508320727 24.583963691376702 22.85678265254665 25.403429147755922 70-71 28.15374921235035 24.234404536862 22.848141146817895 24.763705103969755 72-73 28.791125677549477 24.606075885541408 22.841295852766923 23.761502584142193 74-75 27.32543483740862 25.38442147718679 23.380388202672044 23.909755482732546 76-77 28.139183055975792 23.903177004538577 24.01664145234493 23.940998487140696 78-79 28.324719526030506 25.02205975040968 21.93369469305433 24.719526030505484 80-81 29.016393442622952 24.703656998738964 22.900378310214375 23.37957124842371 82-83 27.798789712556733 25.85728693898134 22.957639939485627 23.3862834089763 84-85 27.56620428751576 25.145018915510718 22.459016393442624 24.829760403530894 86-87 28.007566204287514 25.044136191677175 23.165195460277427 23.78310214375788 88-89 27.51576292559899 26.431273644388398 22.194199243379572 23.85876418663304 90-91 28.189611699445283 25.617750882501262 22.54160363086233 23.651033787191125 92-93 28.328290468986385 26.31114473020676 23.05849722642461 22.30206757438225 94-95 29.259679656955477 24.971623155505107 22.272669945768698 23.496027241770715 96-97 29.43253467843632 25.208070617906685 22.156368221941992 23.203026481715007 98-99 29.05422446406053 26.796973518284993 22.18158890290038 21.9672131147541 100-101 29.14617227897591 26.283263967713456 22.24744608399546 22.323117669315174 102-103 29.155107187894075 26.10340479192938 23.013871374527113 21.727616645649434 104-105 29.697351828499368 27.112232030264817 21.021437578814627 22.168978562421184 106-107 30.05423130281246 26.207592382393745 22.14655063690251 21.591625677891287 108-109 30.0794551645857 26.585950308992306 21.440282507251858 21.894312019170133 110-111 29.798234552332914 26.317780580075663 21.588902900378308 22.295081967213115 112-113 31.46279949558638 26.36822194199243 21.19798234552333 20.970996216897856 114-115 31.866330390920556 26.456494325346785 20.80706179066835 20.870113493064313 116-117 32.09331651954603 26.771752837326606 21.36191677175284 19.773013871374527 118-119 31.19798234552333 26.93568726355612 21.387137452711226 20.47919293820933 120-121 31.68117038718628 26.32109976037331 21.024088787993442 20.973641064446966 122-123 32.61034047919294 26.065573770491802 21.021437578814627 20.302648171500632 124-125 32.61034047919294 26.191677175283733 21.57629255989912 19.62168978562421 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 21.0 1 11.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.5 28 4.0 29 5.5 30 6.0 31 10.5 32 12.5 33 12.5 34 15.5 35 24.5 36 35.5 37 42.5 38 49.5 39 60.5 40 66.5 41 73.5 42 90.5 43 110.5 44 119.0 45 125.5 46 139.0 47 138.0 48 127.0 49 144.5 50 152.5 51 153.5 52 158.0 53 170.0 54 216.0 55 221.5 56 201.0 57 177.5 58 152.0 59 135.0 60 113.0 61 95.5 62 83.0 63 75.0 64 69.5 65 56.0 66 47.0 67 53.0 68 52.5 69 40.0 70 32.5 71 27.5 72 23.0 73 19.0 74 10.5 75 6.5 76 9.0 77 5.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.8 3 0.8 4 0.8750000000000001 5 0.8 6 0.7250000000000001 7 0.675 8 0.65 9 0.65 10-11 0.6375 12-13 1.5625 14-15 3.8249999999999997 16-17 2.8000000000000003 18-19 2.2375 20-21 2.5250000000000004 22-23 1.625 24-25 0.7875 26-27 0.5499999999999999 28-29 0.5625 30-31 0.6 32-33 0.5625 34-35 0.5499999999999999 36-37 0.575 38-39 0.5625 40-41 0.625 42-43 0.6 44-45 0.6 46-47 0.6375 48-49 0.6 50-51 0.5499999999999999 52-53 0.5499999999999999 54-55 0.6625 56-57 0.65 58-59 0.65 60-61 0.65 62-63 0.65 64-65 0.65 66-67 0.65 68-69 0.8500000000000001 70-71 0.8125 72-73 0.8375 74-75 0.8250000000000001 76-77 0.8500000000000001 78-79 0.8375 80-81 0.8750000000000001 82-83 0.8500000000000001 84-85 0.8750000000000001 86-87 0.8750000000000001 88-89 0.8750000000000001 90-91 0.8500000000000001 92-93 0.8500000000000001 94-95 0.8875 96-97 0.8750000000000001 98-99 0.8750000000000001 100-101 0.8875 102-103 0.8750000000000001 104-105 0.8750000000000001 106-107 0.8875 108-109 0.8875 110-111 0.8750000000000001 112-113 0.8750000000000001 114-115 0.8750000000000001 116-117 0.8750000000000001 118-119 0.8750000000000001 120-121 0.8875 122-123 0.8750000000000001 124-125 0.8750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.57316399779127 83.825 2 5.6598564329099945 10.25 3 1.2424075096631695 3.375 4 0.35891772501380453 1.3 5 0.05521811154058532 0.25 6 0.05521811154058532 0.3 7 0.02760905577029266 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02760905577029266 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit GGAAGGCCTACGGGTCGTCAACTTCTTTTCTCGGAGAAGAAACAATGACG 7 0.17500000000000002 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 6 0.15 No Hit GGATACTAGGTGCTGTGCGACTCGACCCGTGCAGTGCTGTAGCTAACGCG 6 0.15 No Hit GTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCTCGCAACGAGCGCAACC 5 0.125 No Hit GCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.07500000000000001 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.21250000000000002 0.0 0.0 0.0 0.0 58-59 0.2875 0.0 0.0 0.0 0.0 60-61 0.3625 0.0 0.0 0.0 0.0 62-63 0.4125 0.0 0.0 0.0 0.0 64-65 0.5125 0.0 0.0 0.0 0.0 66-67 0.6625000000000001 0.0 0.0 0.0 0.0 68-69 0.75 0.0 0.0 0.0 0.0 70-71 0.9 0.0 0.0 0.0 0.0 72-73 1.0625 0.0 0.0 0.0 0.0 74-75 1.4125 0.0 0.0 0.0 0.0 76-77 1.7374999999999998 0.0 0.0 0.0 0.0 78-79 2.25 0.0 0.0 0.0 0.0 80-81 2.75 0.0 0.0 0.0 0.0 82-83 3.5125 0.0 0.0 0.0 0.0 84-85 4.1625 0.0 0.0 0.0 0.0 86-87 4.8875 0.0 0.0 0.0 0.0 88-89 5.75 0.0 0.0 0.0 0.0 90-91 6.675 0.0 0.0 0.0 0.0 92-93 7.987500000000001 0.0 0.0 0.0 0.0 94-95 9.1625 0.0 0.0 0.0 0.0 96-97 10.7125 0.0 0.0 0.0 0.0 98-99 12.3125 0.0 0.0 0.0 0.0 100-101 13.587499999999999 0.0 0.0 0.0 0.0 102-103 15.25 0.0 0.0 0.0 0.0 104-105 17.0875 0.0 0.0 0.0 0.0 106-107 18.8 0.0 0.0 0.0 0.0 108-109 21.0 0.0 0.0 0.0 0.0 110-111 23.137500000000003 0.0 0.0 0.0 0.0 112-113 25.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCATAG 15 0.0040982235 59.443035 46-47 >>END_MODULE Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798290 spots for SRR6789273.sra Written 1798290 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra Read 1798280 spots for SRR6789273.sra Written 1798280 spots for SRR6789273.sra SRR ids: ['SRR6789273.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qsn4z6rb SRR6789273.sra spots: 35965610 blocks: [[1, 1798280], [1798281, 3596560], [3596561, 5394840], [5394841, 7193120], [7193121, 8991400], [8991401, 10789680], [10789681, 12587960], [12587961, 14386240], [14386241, 16184520], [16184521, 17982800], [17982801, 19781080], [19781081, 21579360], [21579361, 23377640], [23377641, 25175920], [25175921, 26974200], [26974201, 28772480], [28772481, 30570760], [30570761, 32369040], [32369041, 34167320], [34167321, 35965610]] SRR6789273 file size 11421434 SRR6789273 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789273 SRR6789273_1.fastq SRR6789273_2.fastq Input file: SRR6789273_1.fastq Paired file: SRR6789273_2.fastq trimmed: SRR6789273-trimmed-pair1.fastq, SRR6789273-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:32:28 2024 >> started Sat Dec 7 12:33:06 2024 >> done (38.287s) 35965610 read pairs processed; of these: 1517 ( 0.00%) short read pairs filtered out after trimming by size control 165031 ( 0.46%) empty read pairs filtered out after trimming by size control 35799062 (99.54%) read pairs available; of these: 14150373 (39.53%) trimmed read pairs available after processing 21648689 (60.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 24 0.00% 20 14 0.00% 21 16 0.00% 22 25 0.00% 23 19 0.00% 24 22 0.00% 25 21 0.00% 26 52 0.00% 27 53 0.00% 28 76 0.00% 29 118 0.00% 30 170 0.00% 31 206 0.00% 32 291 0.00% 33 314 0.00% 34 340 0.00% 35 380 0.00% 36 478 0.00% 37 545 0.00% 38 676 0.00% 39 823 0.00% 40 1018 0.00% 41 1167 0.00% 42 1166 0.00% 43 1294 0.00% 44 1399 0.00% 45 1632 0.00% 46 1850 0.01% 47 2193 0.01% 48 2758 0.01% 49 3326 0.01% 50 3837 0.01% 51 4252 0.01% 52 4745 0.01% 53 5015 0.01% 54 5582 0.02% 55 5879 0.02% 56 6622 0.02% 57 7027 0.02% 58 8489 0.02% 59 9743 0.03% 60 11492 0.03% 61 13479 0.04% 62 14993 0.04% 63 16252 0.05% 64 17757 0.05% 65 18711 0.05% 66 20749 0.06% 67 23008 0.06% 68 24959 0.07% 69 27465 0.08% 70 32301 0.09% 71 36339 0.10% 72 44929 0.13% 73 48050 0.13% 74 51112 0.14% 75 55153 0.15% 76 58806 0.16% 77 62388 0.17% 78 69737 0.19% 79 81947 0.23% 80 88603 0.25% 81 102111 0.29% 82 108886 0.30% 83 121507 0.34% 84 131021 0.37% 85 142964 0.40% 86 150605 0.42% 87 154863 0.43% 88 173376 0.48% 89 178709 0.50% 90 186439 0.52% 91 209526 0.59% 92 228279 0.64% 93 250338 0.70% 94 260169 0.73% 95 281991 0.79% 96 289371 0.81% 97 285960 0.80% 98 288244 0.81% 99 297414 0.83% 100 303846 0.85% 101 316649 0.88% 102 343871 0.96% 103 357192 1.00% 104 374181 1.05% 105 377518 1.05% 106 372598 1.04% 107 373768 1.04% 108 372370 1.04% 109 375002 1.05% 110 371733 1.04% 111 378756 1.06% 112 395066 1.10% 113 396470 1.11% 114 416230 1.16% 115 416113 1.16% 116 413566 1.16% 117 385385 1.08% 118 376061 1.05% 119 371367 1.04% 120 373432 1.04% 121 375431 1.05% 122 374601 1.05% 123 395344 1.10% 124 400148 1.12% 125 21648689 60.47% 35799062 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.96 prefix-fanout=1.9 sequence=GAAGAGCCGACATCGAGGTGCCAAACCTTCCCGTCGATGTGGACTCTTGGGGAAGATCAGCCTGTTATCCCTAGAGTAACTTTTATCCGTTGAGCGACGGCCCTTCCACTCGGCACCGTCGGATCACTAAGGCCGACTTTCGTCTCTGCTCGACGGGTGAGTCTTGCAGTCAAGCTCCCTTCTGCCTTTGCACTCGAGGACCAATGTCCGTCTGGCCCGAGGAAACCTTTGCACGCCTCCGTTACCTTTTGGGAGGCCTACGCCCCATAGAAACTGTCTACCTGAGACTGTCCCTTGGCCCGCGGGTCTGACACAAGGTTAGAATCCGAGCTCTTCCAGAGTGGTATCTCACTGATGGCTCGGGCCCCCCCGGAAGGGGGCCTTCTTCGCCTTCCACCTAAGCTGCGCAGGAAAGGCCCAAAGCCAATCCCAGGGAACAGTAAAGCTTCATAGGGTCTTTCTGTCCAGGTGCAGGTAGTCCGCATCTTCACAGACATGTCTATTTCACCGA criterion=fanout-score sequence-density=0.15 sequence-density-rank=28 fanout-score=10.17 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=3.5 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=1.06 prefix-fanout=2.0 sequence=AACAAAAGGGTA criterion=fanout-score sequence-density=0.18 sequence-density-rank=29 fanout-score=11.58 fanout-score-rank=1 prefix-density=1.39 prefix-fanout=1.5 sequence=GACCACCTTGCCGACCC SRR6789273 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:34:55 Started mapping on | Dec 07 12:34:55 Finished on | Dec 07 12:37:17 Mapping speed, Million of reads per hour | 907.58 Number of input reads | 35799062 Average input read length | 233 UNIQUE READS: Uniquely mapped reads number | 20120139 Uniquely mapped reads % | 56.20% Average mapped length | 236.41 Number of splices: Total | 12362684 Number of splices: Annotated (sjdb) | 11632531 Number of splices: GT/AG | 12178521 Number of splices: GC/AG | 146127 Number of splices: AT/AC | 4137 Number of splices: Non-canonical | 33899 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 8654869 % of reads mapped to multiple loci | 24.18% Number of reads mapped to too many loci | 1498848 % of reads mapped to too many loci | 4.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 13.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7046644 7046644 7046644 N_multimapping 8654869 8654869 8654869 N_noFeature 2712138 19316777 3117366 N_ambiguous 464909 2646 66647 UnstrandedReadsAssigned:16943092 PositiveStrandReadsAssigned:800716 NegativeStrandReadsAssigned:16936126 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=106 echo kmer=101 SRR6789273 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789273-trimmed-pair1.fastq SRR6789273-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,799,062 reads, 18,456,001 reads pseudoaligned [quant] estimated average fragment length: 151.374 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR6789273.ke.tsv 35125 SRR6789273.se.tsv 88098 total ==> SRR6789273.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 785.753 0 0 PNS24247 1044 893.626 52.9334 3.79657 PNS24249 1928 1777.63 51.9838 1.87432 PNS24246 1044 893.626 52.9334 3.79657 PNS24248 1044 893.626 52.9334 3.79657 PNS24244 1471 1320.63 117.216 5.68886 PNS24243 293 147.806 0 0 KQK14069 1603 1452.63 15719.7 693.596 KQK14071 474 324.657 1327.76 262.128 ==> SRR6789273.se.tsv <== BRADI_1g14170v3 19746 BRADI_1g53295v3 11 BRADI_1g59795v3 776 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 98 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 287 BRADI_1g48960v3 0 SRR6789273 completed mapping pipeline successfully