Starting /dee2/code/volunteer_pipeline.sh SRR6789274 current disk space = 1543139332096 free memory = 1605818444 SRR6789274 SRAfilesize b7fffb2e8a43126a2662b779fc7144c9 SRR6789274.sra SRR6789274.sra file validated SRR6789274 is paired end SRR6789274 is conventional basespace SRR6789274 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789274_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19425 33.0 33.0 34.0 31.0 34.0 2 32.23275 33.0 33.0 34.0 31.0 34.0 3 32.161 33.0 33.0 34.0 31.0 34.0 4 31.837 33.0 33.0 34.0 28.0 34.0 5 31.9515 33.0 33.0 34.0 30.0 34.0 6 36.03 38.0 38.0 38.0 33.0 38.0 7 36.2125 38.0 38.0 38.0 33.0 38.0 8 36.1125 38.0 38.0 38.0 33.0 38.0 9 36.158 38.0 38.0 38.0 33.0 38.0 10-11 36.131875 38.0 38.0 38.0 33.0 38.0 12-13 35.791125 38.0 38.0 38.0 31.5 38.0 14-15 35.18425 38.0 38.0 38.0 29.0 38.0 16-17 35.380375 38.0 37.5 38.0 29.0 38.0 18-19 35.641 38.0 38.0 38.0 31.0 38.0 20-21 35.39812499999999 38.0 37.5 38.0 28.5 38.0 22-23 35.574124999999995 38.0 37.5 38.0 28.5 38.0 24-25 35.91525 38.0 38.0 38.0 30.0 38.0 26-27 36.12025 38.0 38.0 38.0 33.0 38.0 28-29 36.117374999999996 38.0 38.0 38.0 33.0 38.0 30-31 36.10375 38.0 38.0 38.0 33.0 38.0 32-33 35.97475 38.0 38.0 38.0 32.0 38.0 34-35 36.1025 38.0 38.0 38.0 33.0 38.0 36-37 36.079625 38.0 38.0 38.0 33.0 38.0 38-39 36.06725 38.0 38.0 38.0 33.0 38.0 40-41 36.152 38.0 38.0 38.0 33.0 38.0 42-43 36.02825 38.0 38.0 38.0 32.5 38.0 44-45 35.932 38.0 37.5 38.0 31.0 38.0 46-47 35.871625 38.0 37.0 38.0 31.0 38.0 48-49 35.866625 38.0 37.5 38.0 31.0 38.0 50-51 35.873125 38.0 37.5 38.0 31.0 38.0 52-53 35.960625 38.0 37.5 38.0 31.5 38.0 54-55 35.847125000000005 38.0 37.5 38.0 31.0 38.0 56-57 35.86 38.0 37.5 38.0 31.0 38.0 58-59 35.820125 38.0 37.0 38.0 31.0 38.0 60-61 35.78725 38.0 37.5 38.0 30.0 38.0 62-63 35.850875 38.0 37.5 38.0 31.0 38.0 64-65 35.6855 38.0 37.0 38.0 29.0 38.0 66-67 35.881375000000006 38.0 37.0 38.0 31.0 38.0 68-69 35.572374999999994 38.0 37.0 38.0 29.0 38.0 70-71 35.684375 38.0 37.0 38.0 30.0 38.0 72-73 35.6315 38.0 37.0 38.0 30.0 38.0 74-75 35.654375 38.0 37.0 38.0 30.0 38.0 76-77 35.557874999999996 38.0 37.0 38.0 29.0 38.0 78-79 35.492375 38.0 37.0 38.0 29.0 38.0 80-81 35.512125 38.0 37.0 38.0 29.0 38.0 82-83 35.463625 38.0 37.0 38.0 29.0 38.0 84-85 35.289500000000004 38.0 37.0 38.0 27.5 38.0 86-87 35.473375 38.0 37.0 38.0 29.0 38.0 88-89 35.263000000000005 38.0 36.5 38.0 28.5 38.0 90-91 35.2345 38.0 36.0 38.0 28.0 38.0 92-93 35.112625 38.0 36.0 38.0 27.5 38.0 94-95 35.131625 38.0 36.0 38.0 27.0 38.0 96-97 35.01375 38.0 36.0 38.0 26.5 38.0 98-99 34.929375 38.0 36.0 38.0 26.0 38.0 100-101 34.936 38.0 36.0 38.0 26.5 38.0 102-103 34.884 38.0 35.5 38.0 25.0 38.0 104-105 34.70625 38.0 35.5 38.0 24.5 38.0 106-107 34.681 38.0 35.0 38.0 24.0 38.0 108-109 34.6345 38.0 35.0 38.0 24.0 38.0 110-111 34.627624999999995 38.0 35.0 38.0 24.0 38.0 112-113 34.510000000000005 38.0 35.0 38.0 23.5 38.0 114-115 34.4825 38.0 35.0 38.0 23.5 38.0 116-117 34.143625 38.0 34.5 38.0 22.0 38.0 118-119 34.1885 38.0 34.0 38.0 23.0 38.0 120-121 34.080375000000004 38.0 34.0 38.0 22.0 38.0 122-123 34.04725 38.0 34.0 38.0 22.0 38.0 124-125 34.107625 38.0 34.5 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 5.0 17 10.0 18 9.0 19 16.0 20 7.0 21 13.0 22 17.0 23 22.0 24 27.0 25 40.0 26 48.0 27 48.0 28 55.0 29 64.0 30 89.0 31 106.0 32 101.0 33 145.0 34 195.0 35 267.0 36 499.0 37 2200.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.884538152610446 19.929718875502008 8.659638554216867 31.52610441767068 2 29.037930168299418 21.67797035920623 29.51519718663652 19.768902285857827 3 21.898543445504774 25.037669512807636 27.77498744349573 25.288799598191865 4 25.358130183463178 32.596129680824326 20.080422216637345 21.965317919075144 5 27.69964841788046 34.530386740331494 17.604218985434457 20.165745856353592 6 25.301204819277107 32.47991967871486 18.699799196787147 23.519076305220885 7 23.1425702811245 16.616465863453815 35.8433734939759 24.397590361445783 8 22.816265060240966 20.582329317269078 23.820281124497992 32.78112449799197 9 24.799196787148595 20.933734939759034 25.727911646586342 28.539156626506024 10-11 28.237951807228917 26.957831325301207 19.139056224899598 25.665160642570285 12-13 26.47356438148242 21.86946622818113 23.75411080192259 27.902858588413864 14-15 26.58832644628099 23.59245867768595 24.89669421487603 24.922520661157023 16-17 27.447216890595012 24.760076775431862 23.10940499040307 24.683301343570058 18-19 26.963717377466583 24.659452577975813 23.34818586887333 25.028644175684278 20-21 26.676031158217338 24.505171753288213 24.313625335206233 24.505171753288213 22-23 26.24113475177305 23.796859169199593 25.012664640324218 24.94934143870314 24-25 25.597183806889618 24.54111139049535 23.635906462157404 26.22579834045763 26-27 25.981683603061096 24.68949943545352 24.965499937272615 24.363317024212773 28-29 26.33295696901267 24.66440848074269 24.024589135616612 24.978045414628028 30-31 26.96361355081556 24.79297365119197 23.82685069008783 24.416562107904642 32-33 26.18569636135508 24.479297365119194 24.968632371392722 24.366373902133 34-35 26.1698657633923 25.00313636933885 24.375862501568186 24.451135365700665 36-37 26.558775561410116 24.262953205369463 23.899134362062476 25.27913687115795 38-39 25.545796737766622 25.38268506900878 24.893350062735255 24.178168130489336 40-41 26.992094365666958 24.118459028736353 24.09336177688543 24.79608482871126 42-43 26.461731493099123 24.62986198243413 24.203262233375156 24.705144291091592 44-45 26.22662818421383 24.043167273183585 24.59530681390388 25.134897728698707 46-47 27.41874764713264 24.319237043543733 24.231396662065503 24.030618647258127 48-49 26.71267252195734 23.93977415307403 24.466750313676286 24.880803011292347 50-51 26.150758810987078 24.118901291860027 24.156528282954973 25.573811614197915 52-53 27.54641244355243 24.7491219267436 24.397892624184646 23.30657300551932 54-55 27.497489959839356 24.573293172690764 24.096385542168676 23.832831325301203 56-57 26.543674698795183 24.07128514056225 25.188253012048197 24.196787148594378 58-59 26.64407630522088 23.795180722891565 24.84939759036145 24.711345381526105 60-61 27.045682730923694 24.711345381526105 24.184236947791167 24.058734939759034 62-63 26.731927710843372 24.021084337349397 25.01255020080321 24.234437751004016 64-65 27.522590361445783 24.623493975903614 24.548192771084338 23.305722891566266 66-67 25.665160642570285 24.949799196787147 24.98744979919679 24.397590361445783 68-69 26.55778894472362 23.969849246231156 25.18844221105528 24.28391959798995 70-71 26.592136666247956 24.054766989071723 24.98429845496797 24.368797889712347 72-73 26.545226130653266 24.71105527638191 24.396984924623116 24.34673366834171 74-75 26.683417085427134 25.65326633165829 24.183417085427138 23.479899497487438 76-77 26.17162960170876 24.764417640407085 24.04824726724463 25.01570549063953 78-79 26.139932169325462 25.097349579198593 23.9919608089436 24.770757442532346 80-81 26.78728483477824 24.47543661263978 24.626209322779243 24.11106922980274 82-83 26.523432592034172 25.769569041336855 23.470285211710014 24.23671315491896 84-85 26.70268911786881 25.722543352601157 23.91304347826087 23.66172405126916 86-87 27.03857268501068 24.538258575197887 25.116220630732506 23.30694810905893 88-89 26.82834883136466 25.182206584568988 24.66700175923599 23.322442824830357 90-91 27.088830255057168 25.29212212589521 24.199019977384093 23.420027641663527 92-93 27.503455207940696 25.769569041336855 23.884910164593542 22.84206558612891 94-95 27.40982782455699 25.361317079301244 24.330777931381174 22.89807716476059 96-97 27.418949484795174 25.89846695149535 23.372706710228698 23.309876853480773 98-99 27.041970344307614 26.903744659462177 23.925609449610455 22.128675546619753 100-101 28.352394118386325 25.298479326379287 23.802940806836748 22.546185748397637 102-103 27.94672028147776 25.69741140990199 24.164362905252577 22.19150540336768 104-105 29.278713244533805 25.57175169640613 23.10882131188741 22.040713747172656 106-107 28.465502073645848 26.24104562020862 23.023752670604498 22.26969963554103 108-109 29.3829332663064 25.637803192157847 23.187130828201582 21.792132713334173 110-111 29.806484041216386 26.212616235234982 22.229203317416435 21.751696406132194 112-113 30.33425483789897 25.860769037446595 21.95275194772556 21.85222417692888 114-115 29.75622015581805 26.237748177934154 22.606182457903994 21.399849208343806 116-117 30.14576526765519 26.33827594873084 22.581050515204826 20.934908268409146 118-119 30.296556923850215 25.634581553154057 22.669012314651923 21.399849208343806 120-121 30.677390976498682 26.957396003518912 22.48334799547568 19.881865024506723 122-123 30.723799949736115 26.70268911786881 23.02085951244031 19.55265141995476 124-125 31.817039457150038 26.614727318421714 21.51294295049007 20.055290273938176 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 6.5 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 2.0 27 2.0 28 2.5 29 3.0 30 6.5 31 10.5 32 12.0 33 18.0 34 27.0 35 32.0 36 43.5 37 55.0 38 62.5 39 89.5 40 112.5 41 120.0 42 134.5 43 158.5 44 169.5 45 154.0 46 149.0 47 154.5 48 148.5 49 151.0 50 145.0 51 136.0 52 137.5 53 130.0 54 127.5 55 140.5 56 135.0 57 115.0 58 109.5 59 98.5 60 96.0 61 96.0 62 78.0 63 70.0 64 77.5 65 72.5 66 66.0 67 72.0 68 64.0 69 46.5 70 36.5 71 31.0 72 28.5 73 21.0 74 13.0 75 8.5 76 3.5 77 2.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.475 3 0.44999999999999996 4 0.525 5 0.44999999999999996 6 0.4 7 0.4 8 0.4 9 0.4 10-11 0.4 12-13 1.175 14-15 3.2 16-17 2.3125 18-19 1.8124999999999998 20-21 2.1125000000000003 22-23 1.3 24-25 0.575 26-27 0.36250000000000004 28-29 0.36250000000000004 30-31 0.375 32-33 0.375 34-35 0.36250000000000004 36-37 0.36250000000000004 38-39 0.375 40-41 0.3875 42-43 0.375 44-45 0.3875 46-47 0.3875 48-49 0.375 50-51 0.3375 52-53 0.35000000000000003 54-55 0.4 56-57 0.4 58-59 0.4 60-61 0.4 62-63 0.4 64-65 0.4 66-67 0.4 68-69 0.5 70-71 0.4875 72-73 0.5 74-75 0.5 76-77 0.5125000000000001 78-79 0.4875 80-81 0.5125000000000001 82-83 0.5125000000000001 84-85 0.525 86-87 0.5125000000000001 88-89 0.525 90-91 0.5125000000000001 92-93 0.5125000000000001 94-95 0.5375 96-97 0.525 98-99 0.525 100-101 0.5375 102-103 0.525 104-105 0.525 106-107 0.5375 108-109 0.5375 110-111 0.525 112-113 0.525 114-115 0.525 116-117 0.525 118-119 0.525 120-121 0.5375 122-123 0.525 124-125 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60015271061339 96.85000000000001 2 1.2725884448969205 2.5 3 0.07635530669381523 0.22499999999999998 4 0.025451768897938407 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025451768897938407 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.3375 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.6 0.0 0.0 0.0 0.0 72-73 0.7875 0.0 0.0 0.0 0.0 74-75 0.9624999999999999 0.0 0.0 0.0 0.0 76-77 1.2875 0.0 0.0 0.0 0.0 78-79 1.55 0.0 0.0 0.0 0.0 80-81 1.7875 0.0 0.0 0.0 0.0 82-83 2.1625 0.0 0.0 0.0 0.0 84-85 2.5125 0.0 0.0 0.0 0.0 86-87 2.9375 0.0 0.0 0.0 0.0 88-89 3.7 0.0 0.0 0.0 0.0 90-91 4.550000000000001 0.0 0.0 0.0 0.0 92-93 5.65 0.0 0.0 0.0 0.0 94-95 6.7625 0.0 0.0 0.0 0.0 96-97 8.075 0.0 0.0 0.0 0.0 98-99 9.524999999999999 0.0 0.0 0.0 0.0 100-101 10.9625 0.0 0.0 0.0 0.0 102-103 12.287500000000001 0.0 0.0 0.0 0.0 104-105 14.2375 0.0 0.0 0.0 0.0 106-107 15.799999999999999 0.0 0.0 0.0 0.0 108-109 17.5375 0.0 0.0 0.0 0.0 110-111 19.0 0.0 0.0 0.0 0.0 112-113 21.262500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6789274 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789274_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72325 33.0 33.0 34.0 32.0 34.0 2 32.7395 34.0 33.0 34.0 31.0 34.0 3 32.6965 34.0 33.0 34.0 31.0 34.0 4 32.44475 34.0 33.0 34.0 31.0 34.0 5 32.308 34.0 33.0 34.0 31.0 34.0 6 36.05225 38.0 36.0 38.0 31.0 38.0 7 36.4185 38.0 37.0 38.0 34.0 38.0 8 36.76475 38.0 38.0 38.0 34.0 38.0 9 36.7635 38.0 38.0 38.0 34.0 38.0 10-11 36.892250000000004 38.0 38.0 38.0 35.0 38.0 12-13 36.94925 38.0 38.0 38.0 35.5 38.0 14-15 36.88675 38.0 38.0 38.0 35.0 38.0 16-17 36.897625000000005 38.0 38.0 38.0 35.0 38.0 18-19 36.888374999999996 38.0 38.0 38.0 35.0 38.0 20-21 36.927125000000004 38.0 38.0 38.0 35.5 38.0 22-23 36.865375 38.0 38.0 38.0 35.0 38.0 24-25 36.726375000000004 38.0 38.0 38.0 34.5 38.0 26-27 36.829499999999996 38.0 38.0 38.0 35.0 38.0 28-29 36.764250000000004 38.0 38.0 38.0 35.0 38.0 30-31 36.820375 38.0 38.0 38.0 35.0 38.0 32-33 36.814875 38.0 38.0 38.0 35.0 38.0 34-35 36.792125 38.0 38.0 38.0 35.0 38.0 36-37 36.751875 38.0 38.0 38.0 35.0 38.0 38-39 36.527 38.0 38.0 38.0 34.0 38.0 40-41 36.533500000000004 38.0 38.0 38.0 34.0 38.0 42-43 36.546375 38.0 38.0 38.0 34.0 38.0 44-45 36.325874999999996 38.0 38.0 38.0 33.5 38.0 46-47 36.437625 38.0 38.0 38.0 34.0 38.0 48-49 36.511875 38.0 38.0 38.0 34.0 38.0 50-51 36.4835 38.0 38.0 38.0 34.0 38.0 52-53 36.362875 38.0 38.0 38.0 33.5 38.0 54-55 36.441 38.0 38.0 38.0 34.0 38.0 56-57 36.316500000000005 38.0 38.0 38.0 33.0 38.0 58-59 36.32425 38.0 38.0 38.0 33.0 38.0 60-61 36.3975 38.0 38.0 38.0 34.0 38.0 62-63 36.253875 38.0 37.5 38.0 33.5 38.0 64-65 36.207750000000004 38.0 37.5 38.0 33.0 38.0 66-67 36.265 38.0 37.0 38.0 33.0 38.0 68-69 36.221125 38.0 37.0 38.0 33.0 38.0 70-71 36.134875 38.0 37.0 38.0 33.0 38.0 72-73 36.208625 38.0 37.0 38.0 33.0 38.0 74-75 36.103375 38.0 37.0 38.0 32.5 38.0 76-77 36.219875 38.0 37.0 38.0 33.0 38.0 78-79 36.13375 38.0 37.0 38.0 33.0 38.0 80-81 36.09375 38.0 37.0 38.0 33.0 38.0 82-83 36.086749999999995 38.0 37.0 38.0 33.0 38.0 84-85 36.12775 38.0 37.0 38.0 33.0 38.0 86-87 36.032375 38.0 37.0 38.0 33.0 38.0 88-89 36.061875 38.0 37.0 38.0 33.0 38.0 90-91 35.886125 38.0 37.0 38.0 31.0 38.0 92-93 35.769999999999996 38.0 37.0 38.0 31.0 38.0 94-95 35.797875000000005 38.0 37.0 38.0 31.5 38.0 96-97 35.6175 38.0 36.0 38.0 29.5 38.0 98-99 35.698499999999996 38.0 36.0 38.0 31.0 38.0 100-101 35.706375 38.0 36.5 38.0 31.0 38.0 102-103 35.554375 38.0 36.0 38.0 30.0 38.0 104-105 35.44 38.0 36.0 38.0 28.5 38.0 106-107 35.462625 38.0 36.0 38.0 29.0 38.0 108-109 35.449749999999995 38.0 36.0 38.0 29.0 38.0 110-111 35.507999999999996 38.0 36.0 38.0 30.0 38.0 112-113 35.13975 38.0 35.0 38.0 28.0 38.0 114-115 35.187375 38.0 35.0 38.0 28.0 38.0 116-117 34.976124999999996 38.0 35.0 38.0 27.5 38.0 118-119 34.74975 38.0 35.0 38.0 26.0 38.0 120-121 34.908125 38.0 35.0 38.0 27.0 38.0 122-123 34.9585 38.0 35.0 38.0 27.0 38.0 124-125 34.979749999999996 38.0 35.0 38.0 27.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 1.0 21 4.0 22 6.0 23 12.0 24 12.0 25 15.0 26 29.0 27 32.0 28 45.0 29 70.0 30 71.0 31 77.0 32 126.0 33 136.0 34 200.0 35 288.0 36 588.0 37 2286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 17.575 7.2749999999999995 35.05 2 25.374999999999996 18.925 34.925 20.775 3 21.50537634408602 24.48112028007002 26.9567391847962 27.056764191047762 4 24.525 30.925000000000004 22.825 21.725 5 25.050352467270898 34.3655589123867 20.896273917421954 19.68781470292044 6 21.15 34.225 23.150000000000002 21.475 7 17.549999999999997 21.975 38.574999999999996 21.9 8 19.925 22.375 26.85 30.85 9 20.375 20.95 30.55 28.125 10-11 23.9125 28.749999999999996 21.025 26.3125 12-13 23.1 22.8125 25.687500000000004 28.4 14-15 22.9375 25.137500000000003 26.3125 25.6125 16-17 23.5375 25.424999999999997 24.6875 26.35 18-19 24.1375 25.05 24.712500000000002 26.1 20-21 23.2125 25.4375 25.424999999999997 25.924999999999997 22-23 24.0 24.75 25.4625 25.7875 24-25 22.95 25.474999999999998 24.85 26.724999999999998 26-27 23.5 24.8 25.412499999999998 26.2875 28-29 24.2625 25.5375 24.6 25.6 30-31 22.775000000000002 25.5 25.0375 26.687499999999996 32-33 23.7125 25.662499999999998 24.337500000000002 26.2875 34-35 24.143535883970994 25.456364091022753 24.58114528632158 25.818954738684667 36-37 24.099999999999998 24.675 25.1875 26.0375 38-39 23.7 24.962500000000002 25.1875 26.150000000000002 40-41 24.8125 25.1 24.0625 26.025 42-43 23.5375 25.025 24.8 26.637499999999996 44-45 23.4875 25.887500000000003 24.6625 25.9625 46-47 24.1375 24.837500000000002 24.275 26.75 48-49 23.825 25.45 24.9125 25.8125 50-51 23.400000000000002 24.7 24.2625 27.6375 52-53 24.462500000000002 24.5375 24.762500000000003 26.237500000000004 54-55 24.5 25.2375 23.400000000000002 26.8625 56-57 23.200000000000003 25.0375 25.275 26.487500000000004 58-59 23.5 25.275 24.975 26.25 60-61 23.55294411801475 24.8906113264158 25.240655081885237 26.31578947368421 62-63 23.7875 24.2375 24.8125 27.1625 64-65 24.575 24.875 24.5125 26.0375 66-67 23.8625 25.0625 24.1375 26.937499999999996 68-69 24.8625 25.087500000000002 23.5625 26.487500000000004 70-71 23.775 24.8625 24.7375 26.625 72-73 24.224999999999998 24.875 25.074999999999996 25.825 74-75 24.7 25.087500000000002 23.9125 26.3 76-77 24.95 24.962500000000002 23.8625 26.224999999999998 78-79 25.025 25.275 23.9375 25.7625 80-81 24.8625 24.65 24.8625 25.624999999999996 82-83 24.762500000000003 25.2875 23.8125 26.137500000000003 84-85 24.75 24.6125 24.425 26.2125 86-87 24.1875 25.137500000000003 23.7 26.974999999999998 88-89 24.7875 25.6125 23.9 25.7 90-91 25.3 24.625 23.3875 26.687499999999996 92-93 25.025 24.875 24.0375 26.0625 94-95 25.456364091022753 24.99374843710928 23.468367091772944 26.081520380095025 96-97 25.015626953369168 25.86573321665208 23.8404800600075 25.278159769971246 98-99 25.59069883735467 25.240655081885237 23.51543942992874 25.653206650831358 100-101 25.531382845711427 25.581395348837212 23.218304576144035 25.668917229307326 102-103 25.09090909090909 26.583072100313483 22.06896551724138 26.257053291536046 104-105 25.309645940197672 26.310521706493184 22.644814212435882 25.73501814087326 106-107 24.899949974987493 26.25062531265633 22.836418209104554 26.013006503251624 108-109 25.874999999999996 25.724999999999998 21.8125 26.5875 110-111 24.875 26.5 23.0375 25.587500000000002 112-113 25.04393673110721 27.278433341702236 22.470499623399448 25.207130303791114 114-115 24.438308020584913 26.120246014811094 22.743818250282416 26.697627714321577 116-117 26.021180030257185 25.239536056480084 22.289460413514878 26.449823499747854 118-119 25.43098024411728 26.19856549641374 21.895054737636844 26.475399521832138 120-121 24.78108581436077 26.720040030022517 22.17913435076307 26.319739804853644 122-123 24.212500000000002 25.874999999999996 22.5625 27.35 124-125 25.4625 25.9625 22.162499999999998 26.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 2.0 27 1.5 28 4.5 29 7.5 30 10.5 31 14.5 32 13.5 33 20.5 34 30.0 35 32.0 36 49.0 37 64.5 38 77.5 39 92.0 40 111.5 41 133.5 42 148.0 43 170.0 44 182.0 45 170.0 46 165.0 47 162.5 48 145.5 49 151.0 50 157.5 51 143.5 52 128.0 53 118.0 54 118.0 55 132.5 56 124.5 57 107.0 58 110.0 59 97.5 60 81.0 61 84.0 62 89.5 63 76.5 64 69.5 65 63.0 66 51.0 67 57.0 68 60.5 69 47.0 70 32.0 71 25.5 72 20.5 73 16.0 74 14.0 75 10.0 76 4.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.7000000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.025 96-97 0.0125 98-99 0.0125 100-101 0.025 102-103 0.3125 104-105 0.08750000000000001 106-107 0.05 108-109 0.0 110-111 0.0 112-113 0.42500000000000004 114-115 0.41250000000000003 116-117 0.8500000000000001 118-119 0.6625 120-121 0.075 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10499359795134 95.775 2 1.4852752880921896 2.9000000000000004 3 0.33290653008962867 0.975 4 0.02560819462227913 0.1 5 0.05121638924455826 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCT 5 0.125 No Hit GTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.525 0.0 0.0 0.0 0.0 72-73 0.7125 0.0 0.0 0.0 0.0 74-75 0.8999999999999999 0.0 0.0 0.0 0.0 76-77 1.15 0.0 0.0 0.0 0.0 78-79 1.4 0.0 0.0 0.0 0.0 80-81 1.6875 0.0 0.0 0.0 0.0 82-83 2.125 0.0 0.0 0.0 0.0 84-85 2.5125 0.0 0.0 0.0 0.0 86-87 2.975 0.0 0.0 0.0 0.0 88-89 3.75 0.0 0.0 0.0 0.0 90-91 4.65 0.0 0.0 0.0 0.0 92-93 5.725 0.0 0.0 0.0 0.0 94-95 6.8125 0.0 0.0 0.0 0.0 96-97 8.125 0.0 0.0 0.0 0.0 98-99 9.600000000000001 0.0 0.0 0.0 0.0 100-101 11.100000000000001 0.0 0.0 0.0 0.0 102-103 12.45 0.0 0.0 0.0 0.0 104-105 14.4125 0.0 0.0 0.0 0.0 106-107 16.05 0.0 0.0 0.0 0.0 108-109 17.8125 0.0 0.0 0.0 0.0 110-111 19.3375 0.0 0.0 0.0 0.0 112-113 21.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832681 spots for SRR6789274.sra Written 1832681 spots for SRR6789274.sra Read 1832699 spots for SRR6789274.sra Written 1832699 spots for SRR6789274.sra SRR ids: ['SRR6789274.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_os8uosth SRR6789274.sra spots: 36653638 blocks: [[1, 1832681], [1832682, 3665362], [3665363, 5498043], [5498044, 7330724], [7330725, 9163405], [9163406, 10996086], [10996087, 12828767], [12828768, 14661448], [14661449, 16494129], [16494130, 18326810], [18326811, 20159491], [20159492, 21992172], [21992173, 23824853], [23824854, 25657534], [25657535, 27490215], [27490216, 29322896], [29322897, 31155577], [31155578, 32988258], [32988259, 34820939], [34820940, 36653638]] SRR6789274 file size 11640130 SRR6789274 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789274 SRR6789274_1.fastq SRR6789274_2.fastq Input file: SRR6789274_1.fastq Paired file: SRR6789274_2.fastq trimmed: SRR6789274-trimmed-pair1.fastq, SRR6789274-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:33:45 2024 >> started Sat Dec 7 12:35:09 2024 >> done (84.457s) 36653638 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 95994 ( 0.26%) empty read pairs filtered out after trimming by size control 36557532 (99.74%) read pairs available; of these: 5062262 (13.85%) trimmed read pairs available after processing 31495270 (86.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 809 0.00% 76 0 0.00% 77 154 0.00% 78 0 0.00% 79 29 0.00% 80 11 0.00% 81 6652 0.02% 82 930 0.00% 83 611 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 2554 0.01% 88 12818 0.04% 89 7232 0.02% 90 242 0.00% 91 2589 0.01% 92 418 0.00% 93 2298 0.01% 94 860 0.00% 95 2329 0.01% 96 25964 0.07% 97 3148 0.01% 98 1958 0.01% 99 3227 0.01% 100 1238 0.00% 101 3336 0.01% 102 20 0.00% 103 5 0.00% 104 317 0.00% 105 3171 0.01% 106 559 0.00% 107 524 0.00% 108 4890 0.01% 109 558 0.00% 110 4937 0.01% 111 43389 0.12% 112 370836 1.01% 113 384162 1.05% 114 400636 1.10% 115 402237 1.10% 116 389144 1.06% 117 370635 1.01% 118 355162 0.97% 119 348371 0.95% 120 350144 0.96% 121 354191 0.97% 122 366024 1.00% 123 396541 1.08% 124 436402 1.19% 125 31495270 86.15% 36557532 reads passed initial QC criterion=sequence-density sequence-density=20.36 sequence-density-rank=1 fanout-score=40.98 fanout-score-rank=1 prefix-density=20.70 prefix-fanout=40.3 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=fanout-score sequence-density=20.36 sequence-density-rank=1 fanout-score=40.98 fanout-score-rank=1 prefix-density=20.70 prefix-fanout=40.3 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=sequence-density sequence-density=20.39 sequence-density-rank=1 fanout-score=41.86 fanout-score-rank=1 prefix-density=20.50 prefix-fanout=41.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=20.39 sequence-density-rank=1 fanout-score=41.86 fanout-score-rank=1 prefix-density=20.50 prefix-fanout=41.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR6789274 SRR6789274_1.fastq SRR6789274_2.fastq Input file: SRR6789274_1.fastq Paired file: SRR6789274_2.fastq trimmed: SRR6789274-trimmed-pair1.fastq, SRR6789274-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:37:42 2024 >> started Sat Dec 7 12:38:25 2024 >> done (43.107s) 33075862 read pairs processed; of these: 644 ( 0.00%) short read pairs filtered out after trimming by size control 20885 ( 0.06%) empty read pairs filtered out after trimming by size control 33054333 (99.93%) read pairs available; of these: 7108682 (21.51%) trimmed read pairs available after processing 25945651 (78.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 18 0.00% 20 13 0.00% 21 25 0.00% 22 15 0.00% 23 13 0.00% 24 15 0.00% 25 138 0.00% 26 28 0.00% 27 43 0.00% 28 46 0.00% 29 64 0.00% 30 57 0.00% 31 91 0.00% 32 137 0.00% 33 149 0.00% 34 156 0.00% 35 225 0.00% 36 1158 0.00% 37 337 0.00% 38 379 0.00% 39 385 0.00% 40 438 0.00% 41 639 0.00% 42 616 0.00% 43 671 0.00% 44 756 0.00% 45 867 0.00% 46 1035 0.00% 47 1293 0.00% 48 1587 0.00% 49 1933 0.01% 50 2235 0.01% 51 2625 0.01% 52 2934 0.01% 53 3049 0.01% 54 3354 0.01% 55 3692 0.01% 56 4085 0.01% 57 4559 0.01% 58 5321 0.02% 59 6242 0.02% 60 7479 0.02% 61 8808 0.03% 62 10005 0.03% 63 10989 0.03% 64 11914 0.04% 65 12722 0.04% 66 13779 0.04% 67 15037 0.05% 68 17126 0.05% 69 19829 0.06% 70 23355 0.07% 71 27516 0.08% 72 31619 0.10% 73 35374 0.11% 74 37866 0.11% 75 41882 0.13% 76 43810 0.13% 77 46683 0.14% 78 50676 0.15% 79 57634 0.17% 80 65352 0.20% 81 79839 0.24% 82 86400 0.26% 83 95866 0.29% 84 103352 0.31% 85 109545 0.33% 86 114454 0.35% 87 120394 0.36% 88 136096 0.41% 89 140063 0.42% 90 146878 0.44% 91 166572 0.50% 92 181493 0.55% 93 199587 0.60% 94 212167 0.64% 95 220187 0.67% 96 242741 0.73% 97 225354 0.68% 98 224799 0.68% 99 234231 0.71% 100 243473 0.74% 101 261790 0.79% 102 281087 0.85% 103 297907 0.90% 104 310605 0.94% 105 316003 0.96% 106 311168 0.94% 107 304329 0.92% 108 303315 0.92% 109 301125 0.91% 110 302750 0.92% 111 315498 0.95% 112 335510 1.02% 113 347631 1.05% 114 362286 1.10% 115 364001 1.10% 116 352361 1.07% 117 335076 1.01% 118 321322 0.97% 119 315287 0.95% 120 316612 0.96% 121 320398 0.97% 122 331282 1.00% 123 357965 1.08% 124 393439 1.19% 125 21371192 64.65% criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=39 prefix-density=0.90 prefix-fanout=1.0 sequence=TTCTCCATGTTCGG criterion=fanout-score sequence-density=0.29 sequence-density-rank=21 fanout-score=11.80 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=4.6 sequence=GAGAACCTCTTCGACCAC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=25 prefix-density=0.85 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=17.79 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.3 sequence=CTTGCAGGTGCTGCAGCCGCAGCCGCCGTTCTCCGCGGCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGCGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG SRR6789274 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:39:12 Started mapping on | Dec 07 12:39:12 Finished on | Dec 07 12:41:44 Mapping speed, Million of reads per hour | 865.33 Number of input reads | 36536003 Average input read length | 236 UNIQUE READS: Uniquely mapped reads number | 31777723 Uniquely mapped reads % | 86.98% Average mapped length | 235.60 Number of splices: Total | 20986045 Number of splices: Annotated (sjdb) | 19732905 Number of splices: GT/AG | 20692254 Number of splices: GC/AG | 251902 Number of splices: AT/AC | 6947 Number of splices: Non-canonical | 34942 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.84 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2188750 % of reads mapped to multiple loci | 5.99% Number of reads mapped to too many loci | 268851 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 2.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2584528 2584528 2584528 N_multimapping 2188750 2188750 2188750 N_noFeature 1700660 2259706 30484817 N_ambiguous 837665 103498 3987 UnstrandedReadsAssigned:29239398 PositiveStrandReadsAssigned:29414519 NegativeStrandReadsAssigned:1288919 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=110 echo kmer=105 SRR6789274 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789274-trimmed-pair1.fastq SRR6789274-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,536,003 reads, 30,495,789 reads pseudoaligned [quant] estimated average fragment length: 149.814 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6789274.ke.tsv 35125 SRR6789274.se.tsv 88098 total ==> SRR6789274.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 787.317 0.000254379 1.41693e-05 PNS24247 1044 895.186 46.3825 2.27225 PNS24249 1928 1779.19 104.994 2.58796 PNS24246 1044 895.186 46.3825 2.27225 PNS24248 1044 895.186 46.3825 2.27225 PNS24244 1471 1322.19 268.859 8.91759 PNS24243 293 149.223 0 0 KQK14069 1603 1454.19 21757.4 656.15 KQK14071 474 326.241 1826.43 245.517 ==> SRR6789274.se.tsv <== BRADI_1g14170v3 26662 BRADI_1g53295v3 41 BRADI_1g59795v3 1979 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 168 BRADI_1g74790v3 212 BRADI_1g09890v3 0 BRADI_1g77505v3 660 BRADI_1g48960v3 0 SRR6789274 completed mapping pipeline successfully