Starting /dee2/code/volunteer_pipeline.sh SRR6789275 current disk space = 1543129251840 free memory = 1603009040 SRR6789275 SRAfilesize 889882e93456b4302efac407e5331f76 SRR6789275.sra SRR6789275.sra file validated SRR6789275 is paired end SRR6789275 is conventional basespace SRR6789275 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789275_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7015 33.0 33.0 34.0 32.0 34.0 2 32.73575 34.0 33.0 34.0 32.0 34.0 3 32.76325 34.0 33.0 34.0 31.0 34.0 4 32.41475 34.0 33.0 34.0 31.0 34.0 5 32.3645 34.0 33.0 34.0 31.0 34.0 6 35.906 38.0 36.0 38.0 31.0 38.0 7 36.51975 38.0 37.0 38.0 34.0 38.0 8 36.7505 38.0 38.0 38.0 35.0 38.0 9 36.6885 38.0 38.0 38.0 34.0 38.0 10-11 36.833875 38.0 38.0 38.0 35.0 38.0 12-13 36.935 38.0 38.0 38.0 35.0 38.0 14-15 36.74725 38.0 38.0 38.0 34.5 38.0 16-17 36.77475 38.0 38.0 38.0 35.0 38.0 18-19 36.8745 38.0 38.0 38.0 35.0 38.0 20-21 36.854625 38.0 38.0 38.0 35.0 38.0 22-23 36.823625 38.0 38.0 38.0 34.5 38.0 24-25 36.7055 38.0 38.0 38.0 34.5 38.0 26-27 36.682874999999996 38.0 38.0 38.0 34.5 38.0 28-29 36.645 38.0 38.0 38.0 34.0 38.0 30-31 36.8055 38.0 38.0 38.0 35.0 38.0 32-33 36.73125 38.0 38.0 38.0 34.0 38.0 34-35 36.734 38.0 38.0 38.0 34.5 38.0 36-37 36.601 38.0 38.0 38.0 34.0 38.0 38-39 36.383375 38.0 38.0 38.0 33.5 38.0 40-41 36.338125000000005 38.0 38.0 38.0 33.0 38.0 42-43 36.350750000000005 38.0 38.0 38.0 34.0 38.0 44-45 36.194375 38.0 37.5 38.0 33.0 38.0 46-47 36.277249999999995 38.0 37.5 38.0 33.0 38.0 48-49 36.353375 38.0 37.5 38.0 33.5 38.0 50-51 36.216499999999996 38.0 37.0 38.0 33.0 38.0 52-53 36.165000000000006 38.0 37.0 38.0 33.0 38.0 54-55 36.243375 38.0 37.5 38.0 33.0 38.0 56-57 36.16 38.0 37.0 38.0 33.0 38.0 58-59 36.083625 38.0 37.0 38.0 32.5 38.0 60-61 36.093875 38.0 37.0 38.0 32.0 38.0 62-63 36.11425 38.0 37.0 38.0 32.5 38.0 64-65 35.96825 38.0 37.0 38.0 31.5 38.0 66-67 36.016000000000005 38.0 37.0 38.0 31.0 38.0 68-69 35.859125 38.0 37.0 38.0 31.0 38.0 70-71 35.797125 38.0 37.0 38.0 30.5 38.0 72-73 35.88475 38.0 37.0 38.0 31.0 38.0 74-75 35.7295 38.0 36.5 38.0 30.0 38.0 76-77 35.901375 38.0 37.0 38.0 31.0 38.0 78-79 35.79175 38.0 37.0 38.0 31.0 38.0 80-81 35.70225 38.0 36.5 38.0 29.5 38.0 82-83 35.726375000000004 38.0 36.5 38.0 30.0 38.0 84-85 35.81375 38.0 37.0 38.0 31.0 38.0 86-87 35.541 38.0 36.0 38.0 29.0 38.0 88-89 35.497 38.0 36.0 38.0 29.5 38.0 90-91 35.33225 38.0 36.0 38.0 29.0 38.0 92-93 35.20225 38.0 36.0 38.0 28.0 38.0 94-95 35.24075 38.0 36.0 38.0 28.0 38.0 96-97 35.1025 38.0 35.5 38.0 28.0 38.0 98-99 35.068250000000006 38.0 35.0 38.0 27.0 38.0 100-101 35.061625 38.0 35.0 38.0 27.0 38.0 102-103 34.9345 38.0 35.0 38.0 27.0 38.0 104-105 34.74225 38.0 35.0 38.0 26.5 38.0 106-107 34.866625 38.0 35.0 38.0 26.5 38.0 108-109 34.645625 38.0 34.5 38.0 25.0 38.0 110-111 34.656 38.0 35.0 38.0 25.5 38.0 112-113 34.208749999999995 38.0 34.0 38.0 23.0 38.0 114-115 34.165875 38.0 34.0 38.0 23.0 38.0 116-117 34.056625 38.0 34.0 38.0 23.0 38.0 118-119 33.8005 38.0 34.0 38.0 22.0 38.0 120-121 33.848124999999996 38.0 34.0 38.0 23.0 38.0 122-123 33.641625000000005 38.0 34.0 38.0 21.0 38.0 124-125 33.637249999999995 38.0 33.5 38.0 21.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 3.0 19 2.0 20 1.0 21 4.0 22 4.0 23 16.0 24 19.0 25 27.0 26 32.0 27 42.0 28 54.0 29 75.0 30 81.0 31 102.0 32 142.0 33 158.0 34 226.0 35 341.0 36 714.0 37 1956.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85 17.299999999999997 10.125 36.725 2 23.275000000000002 20.175 33.550000000000004 23.0 3 20.355088772193046 24.63115778944736 25.731432858214554 29.28232058014504 4 24.7 30.2 23.075000000000003 22.025 5 22.762793042601462 34.38366523821528 22.031762036803627 20.82177968237963 6 20.45 32.275 25.724999999999998 21.55 7 18.224999999999998 21.525 38.45 21.8 8 19.475 22.45 28.849999999999998 29.225 9 18.7 22.35 31.5 27.450000000000003 10-11 23.95 29.2 21.1875 25.662499999999998 12-13 22.575 24.0125 25.937500000000004 27.474999999999998 14-15 22.075 26.4125 25.874999999999996 25.637500000000003 16-17 22.925 26.35 25.8125 24.9125 18-19 23.3875 25.337500000000002 25.0375 26.237500000000004 20-21 21.85 26.637499999999996 25.8 25.7125 22-23 23.1625 26.275 25.412499999999998 25.15 24-25 23.3875 25.637500000000003 25.0625 25.912499999999998 26-27 23.1625 25.7875 25.337500000000002 25.7125 28-29 23.8625 26.187500000000004 24.5625 25.387500000000003 30-31 23.6875 24.887500000000003 25.6 25.825 32-33 23.325000000000003 26.174999999999997 24.962500000000002 25.5375 34-35 23.990498812351543 26.22827853481685 24.57807225903238 25.203150393799223 36-37 24.2875 25.624999999999996 24.224999999999998 25.8625 38-39 22.787499999999998 26.0 25.575 25.637500000000003 40-41 23.375 26.424999999999997 24.5375 25.662499999999998 42-43 23.8125 26.137500000000003 24.4125 25.637500000000003 44-45 23.3875 25.974999999999998 24.65 25.9875 46-47 22.975 26.224999999999998 24.525 26.275 48-49 22.9625 26.737499999999997 24.675 25.624999999999996 50-51 22.675 25.937500000000004 24.775 26.6125 52-53 23.3125 26.687499999999996 25.224999999999998 24.775 54-55 23.724999999999998 26.200000000000003 24.525 25.55 56-57 22.975 25.2 25.387500000000003 26.437500000000004 58-59 24.025 25.887500000000003 25.4625 24.625 60-61 23.80297537192149 25.21565195649456 25.55319414926866 25.428178522315285 62-63 22.375 25.937500000000004 25.087500000000002 26.6 64-65 25.1 24.4125 24.725 25.7625 66-67 23.0625 25.55 24.4375 26.950000000000003 68-69 23.65 26.1125 23.849999999999998 26.387500000000003 70-71 23.1625 25.937500000000004 24.6875 26.2125 72-73 24.075 25.362499999999997 24.625 25.937500000000004 74-75 23.35 25.374999999999996 25.074999999999996 26.200000000000003 76-77 25.337500000000002 24.975 24.2375 25.45 78-79 23.8625 25.924999999999997 24.587500000000002 25.624999999999996 80-81 23.1625 25.362499999999997 24.925 26.55 82-83 24.6875 26.25 24.125 24.9375 84-85 24.95 24.25 24.2375 26.5625 86-87 23.7875 25.7 24.8125 25.7 88-89 24.325 26.1125 24.2875 25.275 90-91 24.762500000000003 25.9875 23.1 26.150000000000002 92-93 24.6125 26.687499999999996 23.7125 24.9875 94-95 24.715589448681087 25.87823477934742 23.65295661957745 25.753219152394045 96-97 25.91573946743343 26.115764470558823 23.202900362545318 24.765595699462434 98-99 25.353169146143266 26.415801975246904 23.51543942992874 24.715589448681087 100-101 24.090511313914238 26.52831603950494 22.99037379672459 26.390798849856235 102-103 25.495111556781147 26.29731762346453 22.51190774630233 25.69566307345199 104-105 24.230673004753562 27.60820615461596 23.329997498123593 24.83112334250688 106-107 25.35633908477119 26.544136034008503 22.093023255813954 26.006501625406354 108-109 24.65 26.474999999999998 22.6375 26.237500000000004 110-111 25.0125 26.5 23.5125 24.975 112-113 25.1035521526296 27.212250533450483 21.70202083594829 25.98217647797163 114-115 25.731508225543138 26.748712796684664 21.863619238980284 25.65615973879191 116-117 24.31511172831713 28.077262971846988 21.878550688044438 25.729074611791443 118-119 24.452279022916144 27.77637874590783 22.09770838579703 25.673633845378994 120-121 24.943707780835627 26.932699524643482 21.128346259694773 26.99524643482612 122-123 24.474999999999998 28.012500000000003 20.974999999999998 26.5375 124-125 24.5 26.974999999999998 22.0125 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 2.5 25 0.5 26 1.0 27 2.0 28 3.0 29 7.0 30 14.0 31 20.5 32 22.0 33 25.0 34 39.0 35 57.5 36 70.0 37 81.5 38 88.5 39 111.5 40 131.5 41 148.5 42 177.5 43 180.0 44 166.5 45 165.0 46 161.5 47 165.0 48 159.5 49 152.0 50 150.0 51 137.0 52 122.5 53 99.5 54 94.0 55 91.5 56 89.0 57 91.0 58 102.0 59 94.5 60 86.0 61 88.0 62 72.5 63 69.5 64 65.0 65 60.0 66 62.0 67 55.5 68 48.0 69 42.0 70 37.5 71 29.5 72 20.0 73 14.0 74 9.0 75 6.5 76 2.5 77 1.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.8250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0125 96-97 0.0125 98-99 0.0125 100-101 0.0125 102-103 0.27499999999999997 104-105 0.075 106-107 0.025 108-109 0.0 110-111 0.0 112-113 0.41250000000000003 114-115 0.46249999999999997 116-117 0.9875 118-119 0.7250000000000001 120-121 0.075 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34563502163401 96.6 2 1.5271061338763043 3.0 3 0.10180707559175363 0.3 4 0.025451768897938407 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2375 0.0 0.0 0.0 0.0 64-65 0.3125 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.5125 0.0 0.0 0.0 0.0 70-71 0.55 0.0 0.0 0.0 0.0 72-73 0.675 0.0 0.0 0.0 0.0 74-75 0.8500000000000001 0.0 0.0 0.0 0.0 76-77 1.1625 0.0 0.0 0.0 0.0 78-79 1.4125 0.0 0.0 0.0 0.0 80-81 1.7375 0.0 0.0 0.0 0.0 82-83 2.0625 0.0 0.0 0.0 0.0 84-85 2.5250000000000004 0.0 0.0 0.0 0.0 86-87 3.0625 0.0 0.0 0.0 0.0 88-89 3.6 0.0 0.0 0.0 0.0 90-91 4.45 0.0 0.0 0.0 0.0 92-93 5.3 0.0 0.0 0.0 0.0 94-95 6.362500000000001 0.0 0.0 0.0 0.0 96-97 7.5 0.0 0.0 0.0 0.0 98-99 8.6625 0.0 0.0 0.0 0.0 100-101 10.075 0.0 0.0 0.0 0.0 102-103 11.3625 0.0 0.0 0.0 0.0 104-105 12.8375 0.0 0.0 0.0 0.0 106-107 14.575 0.0 0.0 0.0 0.0 108-109 16.175 0.0 0.0 0.0 0.0 110-111 17.799999999999997 0.0 0.0 0.0 0.0 112-113 19.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCTT 35 0.0068997513 51.618443 3 >>END_MODULE SRR6789275 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789275_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1045 33.0 33.0 34.0 30.0 34.0 2 32.0865 33.0 33.0 34.0 30.0 34.0 3 32.08825 33.0 33.0 34.0 30.0 34.0 4 31.74175 33.0 33.0 34.0 28.0 34.0 5 31.85425 33.0 33.0 34.0 30.0 34.0 6 35.88475 38.0 38.0 38.0 31.0 38.0 7 35.893 38.0 38.0 38.0 31.0 38.0 8 35.95525 38.0 38.0 38.0 31.0 38.0 9 36.11625 38.0 38.0 38.0 33.0 38.0 10-11 36.029125 38.0 38.0 38.0 31.0 38.0 12-13 35.682500000000005 38.0 38.0 38.0 31.0 38.0 14-15 35.017875000000004 38.0 37.5 38.0 28.5 38.0 16-17 35.18662500000001 38.0 37.0 38.0 28.0 38.0 18-19 35.501125 38.0 38.0 38.0 29.0 38.0 20-21 35.22225 38.0 37.5 38.0 28.5 38.0 22-23 35.301625 38.0 37.0 38.0 28.0 38.0 24-25 35.747125 38.0 37.5 38.0 30.0 38.0 26-27 35.909375 38.0 38.0 38.0 31.0 38.0 28-29 36.030125 38.0 38.0 38.0 33.0 38.0 30-31 35.955875 38.0 38.0 38.0 31.0 38.0 32-33 35.817 38.0 38.0 38.0 30.0 38.0 34-35 35.890375 38.0 37.5 38.0 31.0 38.0 36-37 35.904875000000004 38.0 37.5 38.0 31.0 38.0 38-39 35.9135 38.0 38.0 38.0 31.5 38.0 40-41 35.881125 38.0 38.0 38.0 31.0 38.0 42-43 35.909125 38.0 38.0 38.0 31.0 38.0 44-45 35.74225 38.0 37.5 38.0 30.0 38.0 46-47 35.66825 38.0 37.0 38.0 29.0 38.0 48-49 35.718125 38.0 37.5 38.0 29.0 38.0 50-51 35.829499999999996 38.0 37.0 38.0 30.0 38.0 52-53 35.890125 38.0 37.5 38.0 31.5 38.0 54-55 35.730125 38.0 37.5 38.0 31.0 38.0 56-57 35.66525 38.0 37.0 38.0 29.0 38.0 58-59 35.62025 38.0 37.0 38.0 29.0 38.0 60-61 35.716625 38.0 37.0 38.0 30.0 38.0 62-63 35.747 38.0 37.0 38.0 29.5 38.0 64-65 35.72775 38.0 37.0 38.0 29.5 38.0 66-67 35.646249999999995 38.0 37.0 38.0 29.0 38.0 68-69 35.295125 38.0 37.0 38.0 28.0 38.0 70-71 35.462 38.0 37.0 38.0 29.0 38.0 72-73 35.379374999999996 38.0 37.0 38.0 28.5 38.0 74-75 35.461625 38.0 37.0 38.0 29.0 38.0 76-77 35.329499999999996 38.0 37.0 38.0 28.5 38.0 78-79 35.255 38.0 36.5 38.0 28.0 38.0 80-81 35.32925 38.0 37.0 38.0 28.0 38.0 82-83 35.292500000000004 38.0 37.0 38.0 28.0 38.0 84-85 35.110875 38.0 36.0 38.0 27.0 38.0 86-87 35.20475 38.0 36.0 38.0 28.5 38.0 88-89 35.12175 38.0 36.0 38.0 27.5 38.0 90-91 35.00212500000001 38.0 36.0 38.0 27.0 38.0 92-93 34.9225 38.0 36.0 38.0 26.0 38.0 94-95 34.912375 38.0 36.0 38.0 26.5 38.0 96-97 34.8455 38.0 36.0 38.0 25.5 38.0 98-99 34.778999999999996 38.0 35.5 38.0 25.5 38.0 100-101 34.7495 38.0 35.0 38.0 25.5 38.0 102-103 34.599875 38.0 35.0 38.0 24.0 38.0 104-105 34.443125 38.0 35.0 38.0 23.0 38.0 106-107 34.517125 38.0 35.0 38.0 23.0 38.0 108-109 34.477125 38.0 35.0 38.0 23.0 38.0 110-111 34.30725 38.0 35.0 38.0 23.0 38.0 112-113 34.2355 38.0 35.0 38.0 23.0 38.0 114-115 34.17775 38.0 34.5 38.0 22.0 38.0 116-117 33.97925 38.0 34.0 38.0 22.0 38.0 118-119 33.90275 38.0 34.0 38.0 21.0 38.0 120-121 33.7585 38.0 34.0 38.0 21.0 38.0 122-123 33.811 38.0 34.0 38.0 21.0 38.0 124-125 33.771375 38.0 34.0 38.0 21.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 4.0 16 5.0 17 10.0 18 18.0 19 29.0 20 12.0 21 16.0 22 22.0 23 23.0 24 38.0 25 30.0 26 34.0 27 48.0 28 55.0 29 73.0 30 72.0 31 80.0 32 111.0 33 158.0 34 214.0 35 299.0 36 487.0 37 2140.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.096458176337606 19.768902285857827 11.58000502386335 32.554634513941224 2 28.575025176233638 23.388721047331316 29.85901309164149 18.177240684793556 3 22.004028197381672 26.661631419939575 26.560926485397786 24.773413897280967 4 26.322418136020154 32.49370277078086 19.924433249370278 21.259445843828715 5 27.769385699899296 32.15005035246727 19.86404833836858 20.216515609264853 6 24.798792756539235 30.759557344064387 20.97585513078471 23.46579476861167 7 23.252890899949723 17.169431875314228 34.715937657114125 24.86173956762192 8 22.311557788944725 22.01005025125628 24.64824120603015 31.030150753768844 9 23.121387283236995 22.21663734606685 26.514199547625033 28.147775823071125 10-11 27.179100728460188 25.445867872393872 21.062547098718916 26.31248430042703 12-13 26.628643852978456 21.93916349809886 24.904942965779465 26.527249683143218 14-15 26.282465434810696 24.150407029331955 25.352112676056336 24.215014859801006 16-17 27.420594262295083 24.372438524590166 23.52715163934426 24.67981557377049 18-19 26.479591836734695 24.03061224489796 24.46428571428571 25.02551020408163 20-21 25.940138142747504 25.77385520593502 23.76566896904579 24.52033768227168 22-23 25.719356065407528 25.18696919761694 24.515147673976422 24.57852706299911 24-25 25.550938168996346 24.568694119128573 24.253872308273515 25.626495403601563 26-27 25.91616465863454 24.07128514056225 25.815763052208833 24.196787148594378 28-29 26.869979919678716 24.59839357429719 23.85793172690763 24.673694779116463 30-31 26.12352498116997 24.993723324127544 24.868189806678384 24.0145618880241 32-33 25.935224704996234 24.84308310318855 24.71754958573939 24.50414260607582 34-35 26.568775100401602 24.548192771084338 24.259538152610443 24.623493975903614 36-37 26.995481927710845 24.209337349397593 24.59839357429719 24.196787148594378 38-39 26.638212402711524 24.127542053728344 25.144363545066533 24.0898819984936 40-41 26.46911099949774 24.761426418884984 24.510296333500754 24.25916624811652 42-43 25.508410745669092 24.654782827014813 25.94777805674115 23.889028370574945 44-45 26.004520341536917 24.29683576092416 25.94173782019086 23.756906077348066 46-47 26.90278824415976 24.679728711379052 24.579251444360715 23.838231600100475 48-49 26.449912126537782 24.75520964097414 24.930956565402962 23.863921667085112 50-51 25.52710843373494 25.21335341365462 24.42269076305221 24.836847389558233 52-53 26.402308947170283 24.156104906512738 25.875266658300916 23.566319488016063 54-55 25.911032922844935 24.591605931138478 25.32043226941443 24.17692887660216 56-57 25.43672238280759 25.461857483976374 25.273344225210508 23.82807590800553 58-59 26.767993970606707 24.368797889712347 24.770757442532346 24.0924506971486 60-61 25.907777358964694 25.53084558361603 24.274406332453825 24.28697072496545 62-63 26.360095489383088 25.32981530343008 24.890061565523308 23.420027641663527 64-65 26.262880120633326 25.508921839658207 24.50364413169138 23.72455390801709 66-67 25.533785481034915 24.39085656870133 25.295151971866364 24.780205978397387 68-69 24.92760921566159 25.330479667631877 24.990557723781947 24.75135339292459 70-71 26.812688821752268 24.0055387713998 24.93705941591138 24.244712990936556 72-73 26.063963737093932 25.749181566356082 25.081843364391844 23.105011332158146 74-75 26.63980863653531 24.738763691300516 24.952788618909732 23.668639053254438 76-77 26.463552813798312 24.41143144907466 25.75852952285031 23.366486214276723 78-79 26.73130193905817 24.60337446487031 24.22563585998489 24.43968773608663 80-81 25.903538597154014 24.984258909457246 25.38723082735172 23.724971666037025 82-83 25.89094572471981 25.00944465432565 25.34945221004911 23.75015741090543 84-85 25.793450881612088 24.798488664987406 25.579345088161208 23.828715365239294 86-87 25.941317214456618 24.78277295051001 25.714645510640977 23.561264324392393 88-89 26.889168765743072 24.83627204030227 25.327455919395465 22.947103274559193 90-91 26.495403601561517 24.49313688452336 25.160559123536082 23.850900390379046 92-93 26.91096839189019 26.23095328044327 24.480544012089158 22.377534315577382 94-95 27.660914472855524 25.040937145736237 24.65045975563673 22.647688625771508 96-97 26.82619647355164 25.9823677581864 24.77329974811083 22.418136020151135 98-99 27.61964735516373 25.226700251889167 24.55919395465995 22.594458438287155 100-101 27.53842277651801 26.127488032249936 24.048878810783574 22.285210380448476 102-103 28.2367758186398 26.15869017632242 24.2191435768262 21.385390428211586 104-105 28.123425692695214 25.56675062972292 24.39546599496222 21.91435768261965 106-107 28.033261937759857 25.916593171223383 24.63147284868338 21.418672042333377 108-109 28.93311500188941 26.199773271192843 24.045849603224585 20.82126212369316 110-111 29.030226700251887 25.969773299748113 24.0176322418136 20.9823677581864 112-113 28.690176322418136 26.54911838790932 23.110831234256928 21.649874055415616 114-115 30.188916876574307 25.9823677581864 22.87153652392947 20.957178841309823 116-117 29.55919395465995 26.30982367758186 23.664987405541563 20.465994962216623 118-119 29.848866498740556 26.989924433249367 23.047858942065492 20.113350125944585 120-121 29.777050006298023 26.03602468824789 24.083637737750347 20.103287567703738 122-123 30.768261964735515 26.272040302267 23.047858942065492 19.91183879093199 124-125 29.987405541561714 27.3551637279597 23.047858942065492 19.6095717884131 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 7.5 2 1.0 3 0.5 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 4.0 28 4.5 29 6.0 30 11.5 31 15.0 32 16.5 33 20.0 34 32.0 35 49.5 36 53.0 37 65.5 38 81.5 39 87.5 40 111.0 41 135.0 42 154.5 43 169.5 44 166.0 45 167.5 46 169.5 47 166.5 48 160.0 49 146.0 50 136.5 51 132.5 52 123.0 53 108.0 54 98.5 55 102.5 56 104.0 57 97.5 58 102.5 59 104.0 60 98.5 61 96.5 62 82.5 63 78.0 64 78.0 65 66.5 66 63.5 67 64.0 68 59.0 69 49.0 70 38.5 71 28.5 72 24.5 73 21.5 74 13.0 75 5.5 76 3.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.7000000000000001 3 0.7000000000000001 4 0.75 5 0.7000000000000001 6 0.6 7 0.5499999999999999 8 0.5 9 0.525 10-11 0.475 12-13 1.375 14-15 3.2625 16-17 2.4 18-19 2.0 20-21 2.275 22-23 1.3875 24-25 0.7374999999999999 26-27 0.4 28-29 0.4 30-31 0.42500000000000004 32-33 0.42500000000000004 34-35 0.4 36-37 0.4 38-39 0.42500000000000004 40-41 0.44999999999999996 42-43 0.42500000000000004 44-45 0.44999999999999996 46-47 0.475 48-49 0.42500000000000004 50-51 0.4 52-53 0.3875 54-55 0.525 56-57 0.5375 58-59 0.4875 60-61 0.5125000000000001 62-63 0.5125000000000001 64-65 0.525 66-67 0.475 68-69 0.7125 70-71 0.7000000000000001 72-73 0.7250000000000001 74-75 0.7125 76-77 0.7125 78-79 0.7250000000000001 80-81 0.7374999999999999 82-83 0.7374999999999999 84-85 0.75 86-87 0.7374999999999999 88-89 0.75 90-91 0.7374999999999999 92-93 0.7374999999999999 94-95 0.7625 96-97 0.75 98-99 0.75 100-101 0.775 102-103 0.75 104-105 0.75 106-107 0.7875 108-109 0.7625 110-111 0.75 112-113 0.75 114-115 0.75 116-117 0.75 118-119 0.75 120-121 0.7625 122-123 0.75 124-125 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80619761239522 97.25 2 1.0922021844043688 2.15 3 0.0762001524003048 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025400050800101596 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 15 0.375 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2375 0.0 0.0 0.0 0.0 64-65 0.3125 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.5874999999999999 0.0 0.0 0.0 0.0 70-71 0.6 0.0 0.0 0.0 0.0 72-73 0.7250000000000001 0.0 0.0 0.0 0.0 74-75 0.9125 0.0 0.0 0.0 0.0 76-77 1.1375000000000002 0.0 0.0 0.0 0.0 78-79 1.35 0.0 0.0 0.0 0.0 80-81 1.65 0.0 0.0 0.0 0.0 82-83 2.0 0.0 0.0 0.0 0.0 84-85 2.5374999999999996 0.0 0.0 0.0 0.0 86-87 3.2125000000000004 0.0 0.0 0.0 0.0 88-89 3.825 0.0 0.0 0.0 0.0 90-91 4.800000000000001 0.0 0.0 0.0 0.0 92-93 5.725 0.0 0.0 0.0 0.0 94-95 6.8125 0.0 0.0 0.0 0.0 96-97 8.075 0.0 0.0 0.0 0.0 98-99 9.25 0.0 0.0 0.0 0.0 100-101 10.5 0.0 0.0 0.0 0.0 102-103 11.75 0.0 0.0 0.0 0.0 104-105 13.337499999999999 0.0 0.0 0.0 0.0 106-107 15.15 0.0 0.0 0.0 0.0 108-109 16.7375 0.0 0.0 0.0 0.0 110-111 18.1875 0.0 0.0 0.0 0.0 112-113 19.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766986 spots for SRR6789275.sra Written 1766986 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra Read 1766970 spots for SRR6789275.sra Written 1766970 spots for SRR6789275.sra SRR ids: ['SRR6789275.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mcqlg307 SRR6789275.sra spots: 35339416 blocks: [[1, 1766970], [1766971, 3533940], [3533941, 5300910], [5300911, 7067880], [7067881, 8834850], [8834851, 10601820], [10601821, 12368790], [12368791, 14135760], [14135761, 15902730], [15902731, 17669700], [17669701, 19436670], [19436671, 21203640], [21203641, 22970610], [22970611, 24737580], [24737581, 26504550], [26504551, 28271520], [28271521, 30038490], [30038491, 31805460], [31805461, 33572430], [33572431, 35339416]] SRR6789275 file size 11222398 SRR6789275 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789275 SRR6789275_1.fastq SRR6789275_2.fastq Input file: SRR6789275_1.fastq Paired file: SRR6789275_2.fastq trimmed: SRR6789275-trimmed-pair1.fastq, SRR6789275-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:34:08 2024 >> started Sat Dec 7 12:35:16 2024 >> done (67.666s) 35339416 read pairs processed; of these: 844 ( 0.00%) short read pairs filtered out after trimming by size control 170042 ( 0.48%) empty read pairs filtered out after trimming by size control 35168530 (99.52%) read pairs available; of these: 12147196 (34.54%) trimmed read pairs available after processing 23021334 (65.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 21 0.00% 20 16 0.00% 21 17 0.00% 22 21 0.00% 23 25 0.00% 24 23 0.00% 25 33 0.00% 26 33 0.00% 27 52 0.00% 28 45 0.00% 29 65 0.00% 30 75 0.00% 31 99 0.00% 32 129 0.00% 33 123 0.00% 34 175 0.00% 35 169 0.00% 36 223 0.00% 37 257 0.00% 38 363 0.00% 39 393 0.00% 40 524 0.00% 41 564 0.00% 42 692 0.00% 43 744 0.00% 44 868 0.00% 45 953 0.00% 46 1242 0.00% 47 1424 0.00% 48 1752 0.00% 49 2089 0.01% 50 2485 0.01% 51 2768 0.01% 52 3202 0.01% 53 3387 0.01% 54 3648 0.01% 55 3942 0.01% 56 4439 0.01% 57 5094 0.01% 58 5977 0.02% 59 6922 0.02% 60 8176 0.02% 61 9455 0.03% 62 10676 0.03% 63 11850 0.03% 64 13060 0.04% 65 13757 0.04% 66 15005 0.04% 67 16460 0.05% 68 18949 0.05% 69 21433 0.06% 70 25222 0.07% 71 29185 0.08% 72 33419 0.10% 73 37580 0.11% 74 40560 0.12% 75 44676 0.13% 76 47037 0.13% 77 50234 0.14% 78 55495 0.16% 79 62786 0.18% 80 71715 0.20% 81 84403 0.24% 82 90028 0.26% 83 99072 0.28% 84 107438 0.31% 85 114408 0.33% 86 119875 0.34% 87 129146 0.37% 88 143500 0.41% 89 147785 0.42% 90 155163 0.44% 91 174758 0.50% 92 187888 0.53% 93 205941 0.59% 94 218205 0.62% 95 227443 0.65% 96 249009 0.71% 97 236743 0.67% 98 238211 0.68% 99 247262 0.70% 100 259142 0.74% 101 276549 0.79% 102 292017 0.83% 103 309334 0.88% 104 321421 0.91% 105 326411 0.93% 106 326963 0.93% 107 321233 0.91% 108 321456 0.91% 109 319439 0.91% 110 321586 0.91% 111 328264 0.93% 112 346602 0.99% 113 357378 1.02% 114 366556 1.04% 115 371109 1.06% 116 362649 1.03% 117 352272 1.00% 118 335903 0.96% 119 330564 0.94% 120 330061 0.94% 121 335775 0.95% 122 340084 0.97% 123 356453 1.01% 124 369871 1.05% 125 23021334 65.46% 35168530 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=22 prefix-density=0.91 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=15.39 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.1 sequence=CTTGCAGGTGCTGCAGCCGCAGCCGCCGTTCTCCGCGGCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGCGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.8 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATTATGATAATTT criterion=fanout-score sequence-density=0.34 sequence-density-rank=18 fanout-score=11.51 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=4.6 sequence=GAGAACCTCTTCGACCAC SRR6789275 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:35:53 Started mapping on | Dec 07 12:35:54 Finished on | Dec 07 12:38:34 Mapping speed, Million of reads per hour | 791.29 Number of input reads | 35168530 Average input read length | 236 UNIQUE READS: Uniquely mapped reads number | 31548586 Uniquely mapped reads % | 89.71% Average mapped length | 234.91 Number of splices: Total | 19929871 Number of splices: Annotated (sjdb) | 18715185 Number of splices: GT/AG | 19648983 Number of splices: GC/AG | 238738 Number of splices: AT/AC | 6498 Number of splices: Non-canonical | 35652 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 1.84 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1389481 % of reads mapped to multiple loci | 3.95% Number of reads mapped to too many loci | 200440 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 2.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2256850 2256850 2256850 N_multimapping 1389481 1389481 1389481 N_noFeature 1402819 29757584 2425795 N_ambiguous 871422 4989 102127 UnstrandedReadsAssigned:29274345 PositiveStrandReadsAssigned:1786013 NegativeStrandReadsAssigned:29020664 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=110 echo kmer=105 SRR6789275 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789275-trimmed-pair1.fastq SRR6789275-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,168,530 reads, 29,896,343 reads pseudoaligned [quant] estimated average fragment length: 150.656 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR6789275.ke.tsv 35125 SRR6789275.se.tsv 88098 total ==> SRR6789275.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 786.398 0 0 PNS24247 1044 894.344 38.4201 1.9121 PNS24249 1928 1778.34 52.0703 1.30326 PNS24246 1044 894.344 38.4201 1.9121 PNS24248 1044 894.344 38.4201 1.9121 PNS24244 1471 1321.34 310.67 10.465 PNS24243 293 148.506 1 0.299718 KQK14069 1603 1453.34 19775.6 605.648 KQK14071 474 325.213 987.823 135.198 ==> SRR6789275.se.tsv <== BRADI_1g14170v3 22445 BRADI_1g53295v3 45 BRADI_1g59795v3 1940 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 155 BRADI_1g74790v3 204 BRADI_1g09890v3 0 BRADI_1g77505v3 652 BRADI_1g48960v3 0 SRR6789275 completed mapping pipeline successfully