Starting /dee2/code/volunteer_pipeline.sh SRR6789276 current disk space = 1542797684736 free memory = 1599949852 SRR6789276 SRAfilesize f33920209cfa136b7ad9bee63124f20d SRR6789276.sra SRR6789276.sra file validated SRR6789276 is paired end SRR6789276 is conventional basespace SRR6789276 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789276_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06775 33.0 33.0 34.0 30.0 34.0 2 32.06725 33.0 33.0 34.0 30.0 34.0 3 32.07525 33.0 33.0 34.0 30.0 34.0 4 31.89925 33.0 33.0 34.0 30.0 34.0 5 31.992 33.0 33.0 34.0 31.0 34.0 6 35.96525 38.0 38.0 38.0 31.0 38.0 7 36.046 38.0 38.0 38.0 33.0 38.0 8 36.02575 38.0 38.0 38.0 33.0 38.0 9 36.03825 38.0 38.0 38.0 33.0 38.0 10-11 36.087375 38.0 38.0 38.0 32.0 38.0 12-13 35.787 38.0 38.0 38.0 31.0 38.0 14-15 35.2205 38.0 37.0 38.0 29.0 38.0 16-17 35.313375 38.0 37.5 38.0 28.5 38.0 18-19 35.644375 38.0 38.0 38.0 31.0 38.0 20-21 35.38825 38.0 37.5 38.0 29.0 38.0 22-23 35.460750000000004 38.0 37.0 38.0 28.5 38.0 24-25 35.820125000000004 38.0 37.5 38.0 30.0 38.0 26-27 36.002375 38.0 38.0 38.0 33.0 38.0 28-29 35.9705 38.0 38.0 38.0 32.0 38.0 30-31 36.0435 38.0 38.0 38.0 33.0 38.0 32-33 35.877875 38.0 38.0 38.0 31.0 38.0 34-35 35.981125 38.0 38.0 38.0 32.5 38.0 36-37 35.911 38.0 38.0 38.0 31.0 38.0 38-39 35.9815 38.0 38.0 38.0 31.5 38.0 40-41 35.933875 38.0 38.0 38.0 31.5 38.0 42-43 35.906000000000006 38.0 38.0 38.0 31.5 38.0 44-45 35.807249999999996 38.0 37.5 38.0 30.0 38.0 46-47 35.595625 38.0 37.0 38.0 29.0 38.0 48-49 35.655 38.0 37.0 38.0 29.0 38.0 50-51 35.786625 38.0 37.0 38.0 31.0 38.0 52-53 35.778875 38.0 37.0 38.0 31.0 38.0 54-55 35.747 38.0 37.0 38.0 31.0 38.0 56-57 35.7145 38.0 37.5 38.0 30.0 38.0 58-59 35.642250000000004 38.0 37.0 38.0 29.0 38.0 60-61 35.726875 38.0 37.0 38.0 30.0 38.0 62-63 35.69825 38.0 37.0 38.0 30.0 38.0 64-65 35.636125 38.0 37.0 38.0 29.0 38.0 66-67 35.705 38.0 37.0 38.0 30.0 38.0 68-69 35.3725 38.0 37.0 38.0 28.5 38.0 70-71 35.5625 38.0 37.0 38.0 29.0 38.0 72-73 35.415875 38.0 37.0 38.0 29.0 38.0 74-75 35.538875000000004 38.0 37.0 38.0 29.5 38.0 76-77 35.38975 38.0 37.0 38.0 28.5 38.0 78-79 35.201875 38.0 37.0 38.0 27.0 38.0 80-81 35.29675 38.0 36.5 38.0 28.0 38.0 82-83 35.339 38.0 37.0 38.0 28.5 38.0 84-85 35.237625 38.0 36.0 38.0 28.0 38.0 86-87 35.288375 38.0 36.0 38.0 28.5 38.0 88-89 35.095375000000004 38.0 36.0 38.0 26.5 38.0 90-91 34.98375 38.0 35.5 38.0 26.0 38.0 92-93 34.934625 38.0 35.5 38.0 26.0 38.0 94-95 34.98625 38.0 35.5 38.0 27.0 38.0 96-97 34.6145 38.0 35.0 38.0 23.0 38.0 98-99 34.821 38.0 35.0 38.0 25.5 38.0 100-101 34.734125000000006 38.0 35.0 38.0 24.0 38.0 102-103 34.715875 38.0 35.0 38.0 23.5 38.0 104-105 34.461625 38.0 35.0 38.0 23.0 38.0 106-107 34.470124999999996 38.0 35.0 38.0 23.0 38.0 108-109 34.29175 38.0 34.5 38.0 23.0 38.0 110-111 34.301625 38.0 35.0 38.0 23.0 38.0 112-113 34.193 38.0 34.0 38.0 23.0 38.0 114-115 34.099000000000004 38.0 34.5 38.0 22.0 38.0 116-117 33.786249999999995 38.0 34.0 38.0 19.0 38.0 118-119 33.732375000000005 38.0 34.0 38.0 21.0 38.0 120-121 33.63075 38.0 34.0 38.0 21.0 38.0 122-123 33.62375 38.0 34.0 38.0 21.0 38.0 124-125 33.558375 38.0 34.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 12.0 18 14.0 19 12.0 20 12.0 21 17.0 22 19.0 23 23.0 24 25.0 25 32.0 26 46.0 27 50.0 28 72.0 29 82.0 30 88.0 31 100.0 32 111.0 33 155.0 34 222.0 35 277.0 36 476.0 37 2131.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.78894472361809 19.64824120603015 8.467336683417086 29.095477386934675 2 30.206237424547282 20.397384305835008 28.772635814889334 20.62374245472837 3 24.446680080482896 24.924547283702214 26.98692152917505 23.641851106639837 4 26.339622641509436 31.32075471698113 20.251572327044027 22.08805031446541 5 28.29476861167002 32.469818913480886 17.32897384305835 21.906438631790746 6 26.685110663983902 31.31287726358149 18.008048289738433 23.993963782696177 7 22.844935913546117 16.587082181452626 34.65694898215632 25.911032922844935 8 22.769540085448607 19.82910278964564 23.096255340537823 34.30510178436793 9 24.151796933902993 20.407137471726564 24.55390801708972 30.88715757728072 10-11 28.81015202914939 24.638773715290867 19.73866063575826 26.812413619801482 12-13 26.72653680748798 21.907412092081962 24.07032633442955 27.295724766000507 14-15 26.72923630753407 23.566469529442017 23.977886346104395 25.726407816919515 16-17 28.261147310591543 23.34227673438099 22.06464801328734 26.33192794174013 18-19 27.621710944451504 24.367611541883818 22.473623998983093 25.537053514681578 20-21 26.73380928097909 24.451810300866907 23.610402855685876 25.203977562468125 22-23 26.804254241580143 23.9680931881489 23.5882501899215 25.63940238034946 24-25 26.63898326412483 23.51830879577199 23.757392726815148 26.085315213288034 26-27 26.344221105527637 23.21608040201005 23.869346733668344 26.57035175879397 28-29 26.394472361809047 24.07035175879397 22.939698492462313 26.595477386934675 30-31 26.70854271356784 24.610552763819097 23.354271356783922 25.326633165829143 32-33 27.487437185929647 24.20854271356784 22.412060301507537 25.891959798994975 34-35 27.00665745509358 24.532093958045472 22.63534731817611 25.825901268684838 36-37 26.152493405351084 23.401582715739227 23.778419796507976 26.66750408240171 38-39 27.035175879396984 23.37939698492462 23.655778894472363 25.92964824120603 40-41 27.889447236180903 23.37939698492462 23.253768844221106 25.47738693467337 42-43 27.386934673366838 23.819095477386934 23.040201005025125 25.753768844221103 44-45 26.84673366834171 23.329145728643216 23.869346733668344 25.95477386934673 46-47 27.365246890312854 24.31209950998869 22.52795577333836 25.794697826360096 48-49 26.595477386934675 23.78140703517588 23.668341708542716 25.95477386934673 50-51 26.10224846124859 24.494410249968595 23.489511367918603 25.913829920864213 52-53 26.378595653812337 24.067328225097352 23.904032156764227 25.65004396432609 54-55 27.422395375141384 24.67010179715973 22.84780696242302 25.059695865275856 56-57 27.07966825835637 22.78210605679819 23.812515707464186 26.32570997738125 58-59 25.986428750942448 23.649158079919577 24.227192762000502 26.137220407137473 60-61 27.45664739884393 23.61146016587082 23.422970595627042 25.508921839658207 62-63 26.577029404372958 23.875345564212115 23.812515707464186 25.735109323950738 64-65 27.368685599396837 23.61146016587082 24.817793415431012 24.202060819301334 66-67 26.878612716763005 24.26489067604926 23.29731088213119 25.559185725056548 68-69 27.213279678068407 23.201710261569417 23.81790744466801 25.767102615694164 70-71 27.150402414486923 23.943661971830984 23.428068410462778 25.47786720321932 72-73 26.726197962520438 23.87121116840649 24.323984404477425 25.078606464595648 74-75 26.785714285714285 24.295774647887324 23.893360160965795 25.025150905432596 76-77 27.50597409130927 24.487485850836375 23.129166142623568 24.877373915230788 78-79 27.971324361715507 23.342975726323733 23.64482455037102 25.040875361589737 80-81 26.210539554772982 24.575525091183497 24.261099232800905 24.952836121242612 82-83 27.078354923908943 24.47490881650107 23.73286379071815 24.713872468871838 84-85 27.773584905660375 23.9748427672956 23.77358490566038 24.47798742138365 86-87 26.726197962520438 25.091183498930953 23.921519305747704 24.261099232800905 88-89 28.088050314465406 24.628930817610062 23.10691823899371 24.17610062893082 90-91 28.009055464721417 24.65098729719532 23.64482455037102 23.695132687712235 92-93 27.556282228650485 24.562948056848192 23.77059489372406 24.11017482077726 94-95 27.635220125786162 24.842767295597483 23.484276729559745 24.037735849056606 96-97 28.628930817610065 25.19496855345912 22.51572327044025 23.660377358490567 98-99 27.547169811320753 25.72327044025157 23.11949685534591 23.61006289308176 100-101 29.487985910177382 25.83972826770663 22.317272612907285 22.355013209208703 102-103 28.779874213836475 24.47798742138365 23.672955974842765 23.069182389937108 104-105 28.591194968553456 25.056603773584907 22.628930817610062 23.72327044025157 106-107 28.418669014970437 26.04101144798088 23.097244936469995 22.44307460057869 108-109 30.959869165932822 24.292363819348346 22.355013209208703 22.392753805510125 110-111 29.421383647798745 25.836477987421386 22.22641509433962 22.51572327044025 112-113 29.861635220125788 25.547169811320753 22.10062893081761 22.49056603773585 114-115 31.30817610062893 25.72327044025157 21.22012578616352 21.748427672955977 116-117 30.77987421383648 25.836477987421386 22.57861635220126 20.80503144654088 118-119 31.345911949685533 25.660377358490567 21.647798742138367 21.345911949685533 120-121 31.3875959240156 25.298779720719587 21.902126053591648 21.411498301673166 122-123 32.17610062893081 25.62264150943396 23.0188679245283 19.18238993710692 124-125 30.830188679245285 26.654088050314467 22.025157232704405 20.49056603773585 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 9.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 1.0 27 1.5 28 3.0 29 4.0 30 6.5 31 6.0 32 10.0 33 18.5 34 26.0 35 37.0 36 48.0 37 53.0 38 62.0 39 72.0 40 79.5 41 85.5 42 104.0 43 131.5 44 136.5 45 134.5 46 145.0 47 148.0 48 132.0 49 132.5 50 147.0 51 140.0 52 129.0 53 124.0 54 124.0 55 131.0 56 138.5 57 134.5 58 121.5 59 120.0 60 111.5 61 103.5 62 96.0 63 84.5 64 85.0 65 86.5 66 79.5 67 71.5 68 66.0 69 64.5 70 57.5 71 44.0 72 35.5 73 27.5 74 22.5 75 17.0 76 13.5 77 11.0 78 6.0 79 3.0 80 1.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.6 3 0.6 4 0.625 5 0.6 6 0.6 7 0.525 8 0.525 9 0.525 10-11 0.5125000000000001 12-13 1.175 14-15 2.775 16-17 2.1624999999999996 18-19 1.6625 20-21 1.95 22-23 1.275 24-25 0.6625 26-27 0.5 28-29 0.5 30-31 0.5 32-33 0.5 34-35 0.4875 36-37 0.4875 38-39 0.5 40-41 0.5 42-43 0.5 44-45 0.5 46-47 0.5125000000000001 48-49 0.5 50-51 0.4875 52-53 0.4875 54-55 0.5375 56-57 0.525 58-59 0.525 60-61 0.525 62-63 0.525 64-65 0.525 66-67 0.525 68-69 0.6 70-71 0.6 72-73 0.6125 74-75 0.6 76-77 0.6125 78-79 0.6125 80-81 0.6125 82-83 0.6125 84-85 0.625 86-87 0.6125 88-89 0.625 90-91 0.6125 92-93 0.6125 94-95 0.625 96-97 0.625 98-99 0.625 100-101 0.6375 102-103 0.625 104-105 0.625 106-107 0.6375 108-109 0.6375 110-111 0.625 112-113 0.625 114-115 0.625 116-117 0.625 118-119 0.625 120-121 0.6375 122-123 0.625 124-125 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.84228101721038 95.22500000000001 2 2.003596198304649 3.9 3 0.10274852298998202 0.3 4 0.025687130747495505 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025687130747495505 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 19 0.475 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.037500000000000006 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.21250000000000002 0.0 0.0 0.0 0.0 62-63 0.2875 0.0 0.0 0.0 0.0 64-65 0.425 0.0 0.0 0.0 0.0 66-67 0.5625 0.0 0.0 0.0 0.0 68-69 0.7125 0.0 0.0 0.0 0.0 70-71 0.8500000000000001 0.0 0.0 0.0 0.0 72-73 1.15 0.0 0.0 0.0 0.0 74-75 1.4500000000000002 0.0 0.0 0.0 0.0 76-77 1.8 0.0 0.0 0.0 0.0 78-79 2.1125 0.0 0.0 0.0 0.0 80-81 2.4875 0.0 0.0 0.0 0.0 82-83 3.0 0.0 0.0 0.0 0.0 84-85 3.625 0.0 0.0 0.0 0.0 86-87 4.475 0.0 0.0 0.0 0.0 88-89 5.375 0.0 0.0 0.0 0.0 90-91 6.5375 0.0 0.0 0.0 0.0 92-93 7.7749999999999995 0.0 0.0 0.0 0.0 94-95 9.0125 0.0 0.0 0.0 0.0 96-97 10.275 0.0 0.0 0.0 0.0 98-99 11.9375 0.0 0.0 0.0 0.0 100-101 13.775 0.0 0.0 0.0 0.0 102-103 15.399999999999999 0.0 0.0 0.0 0.0 104-105 17.3375 0.0 0.0 0.0 0.0 106-107 19.1125 0.0 0.0 0.0 0.0 108-109 20.8125 0.0 0.0 0.0 0.0 110-111 22.75 0.0 0.0 0.0 0.0 112-113 24.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6789276 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789276_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58825 33.0 33.0 34.0 32.0 34.0 2 32.69925 34.0 33.0 34.0 31.0 34.0 3 32.7215 34.0 33.0 34.0 32.0 34.0 4 32.318 33.0 33.0 34.0 31.0 34.0 5 32.37125 33.0 33.0 34.0 31.0 34.0 6 35.88925 38.0 36.0 38.0 31.0 38.0 7 36.388 38.0 37.0 38.0 33.0 38.0 8 36.718 38.0 38.0 38.0 34.0 38.0 9 36.69525 38.0 38.0 38.0 34.0 38.0 10-11 36.789125 38.0 38.0 38.0 35.0 38.0 12-13 36.856125 38.0 38.0 38.0 35.0 38.0 14-15 36.883125 38.0 38.0 38.0 35.0 38.0 16-17 36.90425 38.0 38.0 38.0 35.0 38.0 18-19 36.83225 38.0 38.0 38.0 35.0 38.0 20-21 36.881375000000006 38.0 38.0 38.0 35.0 38.0 22-23 36.797 38.0 38.0 38.0 35.0 38.0 24-25 36.690749999999994 38.0 38.0 38.0 34.0 38.0 26-27 36.76275 38.0 38.0 38.0 34.5 38.0 28-29 36.642250000000004 38.0 38.0 38.0 34.0 38.0 30-31 36.797 38.0 38.0 38.0 35.0 38.0 32-33 36.832750000000004 38.0 38.0 38.0 35.0 38.0 34-35 36.83 38.0 38.0 38.0 35.0 38.0 36-37 36.73975 38.0 38.0 38.0 34.5 38.0 38-39 36.4195 38.0 38.0 38.0 34.0 38.0 40-41 36.488375000000005 38.0 38.0 38.0 34.0 38.0 42-43 36.39675 38.0 38.0 38.0 33.5 38.0 44-45 36.265125 38.0 38.0 38.0 33.0 38.0 46-47 36.318375 38.0 38.0 38.0 33.0 38.0 48-49 36.470375000000004 38.0 38.0 38.0 33.5 38.0 50-51 36.403875 38.0 38.0 38.0 34.0 38.0 52-53 36.217625 38.0 37.0 38.0 33.0 38.0 54-55 36.338375 38.0 37.5 38.0 33.0 38.0 56-57 36.200625 38.0 37.0 38.0 33.0 38.0 58-59 36.185500000000005 38.0 37.0 38.0 33.0 38.0 60-61 36.19975 38.0 37.0 38.0 33.0 38.0 62-63 36.182874999999996 38.0 37.0 38.0 33.0 38.0 64-65 36.232 38.0 37.0 38.0 33.0 38.0 66-67 36.160624999999996 38.0 37.0 38.0 33.0 38.0 68-69 36.109125000000006 38.0 37.0 38.0 32.0 38.0 70-71 35.96325 38.0 37.0 38.0 32.0 38.0 72-73 36.056375 38.0 37.0 38.0 32.5 38.0 74-75 35.924625 38.0 37.0 38.0 31.5 38.0 76-77 36.0225 38.0 37.0 38.0 32.5 38.0 78-79 35.970124999999996 38.0 37.0 38.0 32.0 38.0 80-81 35.812375 38.0 37.0 38.0 31.0 38.0 82-83 35.93325 38.0 37.0 38.0 31.0 38.0 84-85 35.947 38.0 37.0 38.0 31.5 38.0 86-87 35.86025 38.0 37.0 38.0 31.0 38.0 88-89 35.86325 38.0 37.0 38.0 31.0 38.0 90-91 35.713375 38.0 36.0 38.0 31.0 38.0 92-93 35.457375 38.0 36.0 38.0 30.0 38.0 94-95 35.433875 38.0 36.0 38.0 29.0 38.0 96-97 35.3995 38.0 36.0 38.0 29.0 38.0 98-99 35.585875 38.0 36.0 38.0 31.0 38.0 100-101 35.4875 38.0 36.0 38.0 29.0 38.0 102-103 35.166 38.0 35.5 38.0 28.5 38.0 104-105 35.253625 38.0 35.5 38.0 27.5 38.0 106-107 35.320499999999996 38.0 35.5 38.0 29.0 38.0 108-109 35.172124999999994 38.0 35.0 38.0 28.0 38.0 110-111 35.333124999999995 38.0 35.0 38.0 29.0 38.0 112-113 34.917125 38.0 35.0 38.0 27.0 38.0 114-115 34.9375 38.0 35.0 38.0 27.0 38.0 116-117 34.75025 38.0 35.0 38.0 26.0 38.0 118-119 34.605999999999995 38.0 35.0 38.0 25.0 38.0 120-121 34.801249999999996 38.0 35.0 38.0 26.0 38.0 122-123 34.652 38.0 35.0 38.0 24.5 38.0 124-125 34.84725 38.0 35.0 38.0 26.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 3.0 22 3.0 23 6.0 24 6.0 25 22.0 26 37.0 27 33.0 28 55.0 29 79.0 30 87.0 31 98.0 32 119.0 33 164.0 34 180.0 35 325.0 36 625.0 37 2155.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.575 20.424999999999997 6.7250000000000005 32.275 2 26.450000000000003 19.650000000000002 32.2 21.7 3 21.575 25.85 27.925 24.65 4 24.474999999999998 29.9 23.7 21.925 5 26.018099547511316 31.473102061337354 21.543489190548016 20.96530920060332 6 23.25 33.2 21.475 22.075 7 20.0 20.3 37.075 22.625 8 21.675 20.474999999999998 25.8 32.05 9 21.05 19.05 29.925 29.975 10-11 26.137500000000003 28.037499999999998 19.9625 25.8625 12-13 24.224999999999998 23.0375 25.324999999999996 27.4125 14-15 24.1125 23.9125 25.087500000000002 26.887499999999996 16-17 23.825 25.324999999999996 23.7625 27.0875 18-19 24.575 24.587500000000002 24.8125 26.025 20-21 24.099999999999998 25.087500000000002 24.65 26.1625 22-23 24.462500000000002 25.2125 23.75 26.575 24-25 24.762500000000003 24.0 24.2 27.037499999999998 26-27 23.4125 24.025 24.85 27.712500000000002 28-29 23.9375 25.0625 24.6875 26.3125 30-31 24.4375 24.425 25.2875 25.85 32-33 25.2625 23.962500000000002 23.9125 26.8625 34-35 25.690711338917367 24.50306288286036 23.6029503687961 26.20327540942618 36-37 24.6875 24.462500000000002 23.925 26.924999999999997 38-39 24.0 24.712500000000002 23.6625 27.625 40-41 24.8625 24.8125 23.7875 26.5375 42-43 24.675 24.05 24.15 27.125 44-45 25.0125 24.325 23.8625 26.8 46-47 25.2375 24.875 24.1625 25.724999999999998 48-49 24.962500000000002 24.5375 24.087500000000002 26.4125 50-51 24.3625 24.2625 24.3625 27.0125 52-53 25.474999999999998 24.1375 23.549999999999997 26.8375 54-55 24.25 24.2375 24.0625 27.450000000000003 56-57 25.174999999999997 23.1 24.4375 27.287499999999998 58-59 24.65 23.7 24.625 27.025 60-61 25.090636329541194 24.46555819477435 23.627953494186773 26.815851981497683 62-63 25.424999999999997 22.7375 24.55 27.287499999999998 64-65 25.474999999999998 23.8125 23.8375 26.875 66-67 24.75 24.45 23.8625 26.937499999999996 68-69 24.825 24.375 23.35 27.450000000000003 70-71 25.4625 24.8625 23.5375 26.137500000000003 72-73 25.55 23.625 23.9375 26.887499999999996 74-75 25.7375 24.4125 24.3 25.55 76-77 25.45 24.0 24.075 26.474999999999998 78-79 25.35 23.75 23.4375 27.462500000000002 80-81 26.3 24.075 22.9875 26.637499999999996 82-83 26.1125 24.25 22.95 26.687499999999996 84-85 25.337500000000002 24.7875 23.1 26.775 86-87 25.55 23.9875 23.474999999999998 26.987499999999997 88-89 25.7875 24.4875 23.674999999999997 26.05 90-91 25.324999999999996 25.6125 22.162499999999998 26.900000000000002 92-93 26.437500000000004 24.775 22.787499999999998 26.0 94-95 26.89086135766971 24.915614451806476 22.765345668208525 25.428178522315285 96-97 26.16577072134017 24.79059882485311 22.527815976997125 26.515814476809602 98-99 26.778347293411674 24.978122265283158 21.590198774846854 26.653331666458307 100-101 27.015876984623077 25.465683210401302 22.42780347543443 25.090636329541194 102-103 25.947302383939775 24.66750313676286 22.73525721455458 26.649937264742785 104-105 26.326326326326328 25.7007007007007 21.896896896896898 26.076076076076077 106-107 26.713356678339167 26.100550275137568 21.435717858929465 25.7503751875938 108-109 26.924999999999997 25.4875 21.45 26.137500000000003 110-111 25.15 26.1625 21.425 27.2625 112-113 26.25031414928374 26.300578034682083 21.161095752701684 26.288012063332495 114-115 26.343545956805624 25.51481667503767 21.057257659467606 27.0843797086891 116-117 25.65913964929986 25.65913964929986 20.966317648542955 27.715403052857322 118-119 25.66427402090417 26.747261050245562 20.979725475380935 26.608739453469337 120-121 26.37376392539742 26.010764801602203 21.053949180122668 26.56152209287771 122-123 24.462500000000002 26.4625 20.5625 28.512500000000003 124-125 24.962500000000002 26.387500000000003 21.2 27.450000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 2.5 28 3.0 29 4.0 30 8.0 31 12.5 32 14.5 33 20.5 34 29.5 35 41.0 36 49.5 37 58.5 38 70.5 39 84.0 40 93.5 41 100.5 42 126.5 43 135.5 44 130.0 45 137.0 46 144.5 47 151.0 48 154.5 49 148.5 50 141.5 51 132.0 52 125.5 53 117.0 54 130.0 55 150.0 56 141.5 57 131.0 58 125.5 59 112.5 60 94.5 61 91.5 62 84.0 63 79.5 64 85.0 65 77.0 66 64.5 67 62.0 68 61.0 69 66.5 70 53.5 71 32.0 72 29.5 73 26.0 74 18.5 75 14.5 76 10.5 77 8.5 78 6.5 79 2.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0125 96-97 0.0125 98-99 0.0125 100-101 0.0125 102-103 0.375 104-105 0.1 106-107 0.05 108-109 0.0 110-111 0.0 112-113 0.525 114-115 0.44999999999999996 116-117 0.9125 118-119 0.7374999999999999 120-121 0.13749999999999998 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.15541763641066 93.925 2 2.404965089216447 4.65 3 0.3361779156969227 0.975 4 0.0517196793379881 0.2 5 0.0517196793379881 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCGCGCAGC 5 0.125 No Hit GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.037500000000000006 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.3125 0.0 0.0 0.0 0.0 64-65 0.45 0.0 0.0 0.0 0.0 66-67 0.6000000000000001 0.0 0.0 0.0 0.0 68-69 0.7625 0.0 0.0 0.0 0.0 70-71 0.8999999999999999 0.0 0.0 0.0 0.0 72-73 1.25 0.0 0.0 0.0 0.0 74-75 1.5499999999999998 0.0 0.0 0.0 0.0 76-77 1.875 0.0 0.0 0.0 0.0 78-79 2.2 0.0 0.0 0.0 0.0 80-81 2.575 0.0 0.0 0.0 0.0 82-83 3.0999999999999996 0.0 0.0 0.0 0.0 84-85 3.7125 0.0 0.0 0.0 0.0 86-87 4.575 0.0 0.0 0.0 0.0 88-89 5.5375 0.0 0.0 0.0 0.0 90-91 6.75 0.0 0.0 0.0 0.0 92-93 7.9375 0.0 0.0 0.0 0.0 94-95 9.1875 0.0 0.0 0.0 0.0 96-97 10.4125 0.0 0.0 0.0 0.0 98-99 12.0125 0.0 0.0 0.0 0.0 100-101 13.8625 0.0 0.0 0.0 0.0 102-103 15.399999999999999 0.0 0.0 0.0 0.0 104-105 17.325 0.0 0.0 0.0 0.0 106-107 19.0875 0.0 0.0 0.0 0.0 108-109 20.7625 0.0 0.0 0.0 0.0 110-111 22.7125 0.0 0.0 0.0 0.0 112-113 24.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694137 spots for SRR6789276.sra Written 1694137 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra Read 1694126 spots for SRR6789276.sra Written 1694126 spots for SRR6789276.sra SRR ids: ['SRR6789276.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd___o3a0gi SRR6789276.sra spots: 33882531 blocks: [[1, 1694126], [1694127, 3388252], [3388253, 5082378], [5082379, 6776504], [6776505, 8470630], [8470631, 10164756], [10164757, 11858882], [11858883, 13553008], [13553009, 15247134], [15247135, 16941260], [16941261, 18635386], [18635387, 20329512], [20329513, 22023638], [22023639, 23717764], [23717765, 25411890], [25411891, 27106016], [27106017, 28800142], [28800143, 30494268], [30494269, 32188394], [32188395, 33882531]] SRR6789276 file size 10759289 SRR6789276 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789276 SRR6789276_1.fastq SRR6789276_2.fastq Input file: SRR6789276_1.fastq Paired file: SRR6789276_2.fastq trimmed: SRR6789276-trimmed-pair1.fastq, SRR6789276-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:42:11 2024 >> started Sat Dec 7 12:42:44 2024 >> done (33.827s) 33882531 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 87948 ( 0.26%) empty read pairs filtered out after trimming by size control 33794470 (99.74%) read pairs available; of these: 5048319 (14.94%) trimmed read pairs available after processing 28746151 (85.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 729 0.00% 76 0 0.00% 77 141 0.00% 78 0 0.00% 79 26 0.00% 80 15 0.00% 81 6041 0.02% 82 760 0.00% 83 540 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 2353 0.01% 88 11438 0.03% 89 6622 0.02% 90 220 0.00% 91 2437 0.01% 92 393 0.00% 93 2018 0.01% 94 783 0.00% 95 2097 0.01% 96 23380 0.07% 97 2947 0.01% 98 1625 0.00% 99 2855 0.01% 100 1143 0.00% 101 3089 0.01% 102 20 0.00% 103 1 0.00% 104 291 0.00% 105 2901 0.01% 106 521 0.00% 107 458 0.00% 108 4395 0.01% 109 489 0.00% 110 4991 0.01% 111 44172 0.13% 112 382543 1.13% 113 400705 1.19% 114 416675 1.23% 115 414440 1.23% 116 392722 1.16% 117 361494 1.07% 118 340357 1.01% 119 331605 0.98% 120 335020 0.99% 121 343609 1.02% 122 362646 1.07% 123 398389 1.18% 124 438223 1.30% 125 28746151 85.06% 33794470 reads passed initial QC criterion=sequence-density sequence-density=23.99 sequence-density-rank=1 fanout-score=41.80 fanout-score-rank=1 prefix-density=24.35 prefix-fanout=41.2 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=fanout-score sequence-density=23.99 sequence-density-rank=1 fanout-score=41.80 fanout-score-rank=1 prefix-density=24.35 prefix-fanout=41.2 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=sequence-density sequence-density=23.94 sequence-density-rank=1 fanout-score=40.80 fanout-score-rank=1 prefix-density=24.06 prefix-fanout=40.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=23.94 sequence-density-rank=1 fanout-score=40.80 fanout-score-rank=1 prefix-density=24.06 prefix-fanout=40.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR6789276 SRR6789276_1.fastq SRR6789276_2.fastq Input file: SRR6789276_1.fastq Paired file: SRR6789276_2.fastq trimmed: SRR6789276-trimmed-pair1.fastq, SRR6789276-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:45:49 2024 >> started Sat Dec 7 12:46:26 2024 >> done (37.242s) 30978264 read pairs processed; of these: 608 ( 0.00%) short read pairs filtered out after trimming by size control 23433 ( 0.08%) empty read pairs filtered out after trimming by size control 30954223 (99.92%) read pairs available; of these: 7827333 (25.29%) trimmed read pairs available after processing 23126890 (74.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 25 0.00% 20 18 0.00% 21 15 0.00% 22 13 0.00% 23 6 0.00% 24 19 0.00% 25 132 0.00% 26 26 0.00% 27 43 0.00% 28 61 0.00% 29 70 0.00% 30 78 0.00% 31 113 0.00% 32 155 0.00% 33 147 0.00% 34 205 0.00% 35 265 0.00% 36 1126 0.00% 37 412 0.00% 38 511 0.00% 39 546 0.00% 40 719 0.00% 41 918 0.00% 42 937 0.00% 43 1051 0.00% 44 1113 0.00% 45 1319 0.00% 46 1568 0.01% 47 1914 0.01% 48 2439 0.01% 49 3127 0.01% 50 3511 0.01% 51 4227 0.01% 52 4494 0.01% 53 4800 0.02% 54 5008 0.02% 55 5438 0.02% 56 5950 0.02% 57 6661 0.02% 58 7866 0.03% 59 9194 0.03% 60 11352 0.04% 61 13151 0.04% 62 14815 0.05% 63 15884 0.05% 64 16894 0.05% 65 17135 0.06% 66 18672 0.06% 67 20007 0.06% 68 22268 0.07% 69 26046 0.08% 70 31294 0.10% 71 36750 0.12% 72 43462 0.14% 73 46724 0.15% 74 48791 0.16% 75 51987 0.17% 76 53353 0.17% 77 56206 0.18% 78 60884 0.20% 79 69403 0.22% 80 79680 0.26% 81 97447 0.31% 82 106825 0.35% 83 117386 0.38% 84 125397 0.41% 85 128829 0.42% 86 130676 0.42% 87 133680 0.43% 88 149064 0.48% 89 153690 0.50% 90 164061 0.53% 91 190417 0.62% 92 209867 0.68% 93 231565 0.75% 94 240497 0.78% 95 244679 0.79% 96 256422 0.83% 97 238436 0.77% 98 234910 0.76% 99 242837 0.78% 100 255726 0.83% 101 279097 0.90% 102 306156 0.99% 103 328110 1.06% 104 341786 1.10% 105 335281 1.08% 106 326293 1.05% 107 310155 1.00% 108 303893 0.98% 109 301269 0.97% 110 305795 0.99% 111 321559 1.04% 112 350568 1.13% 113 367385 1.19% 114 382029 1.23% 115 379669 1.23% 116 359925 1.16% 117 331286 1.07% 118 312270 1.01% 119 304034 0.98% 120 307039 0.99% 121 314900 1.02% 122 332056 1.07% 123 365003 1.18% 124 399954 1.29% 125 18505281 59.78% criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=15 prefix-density=1.11 prefix-fanout=2.8 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATTATGATAATTTACCGGT criterion=fanout-score sequence-density=0.15 sequence-density-rank=31 fanout-score=9.16 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=1.5 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=17 prefix-density=1.00 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.28 sequence-density-rank=26 fanout-score=12.33 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA SRR6789276 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:47:11 Started mapping on | Dec 07 12:47:11 Finished on | Dec 07 12:49:07 Mapping speed, Million of reads per hour | 1048.05 Number of input reads | 33770429 Average input read length | 234 UNIQUE READS: Uniquely mapped reads number | 27911540 Uniquely mapped reads % | 82.65% Average mapped length | 233.08 Number of splices: Total | 16325101 Number of splices: Annotated (sjdb) | 15378924 Number of splices: GT/AG | 16099816 Number of splices: GC/AG | 189352 Number of splices: AT/AC | 4692 Number of splices: Non-canonical | 31241 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2459602 % of reads mapped to multiple loci | 7.28% Number of reads mapped to too many loci | 447941 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 5.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3411747 3411747 3411747 N_multimapping 2459602 2459602 2459602 N_noFeature 1388665 2090565 26598833 N_ambiguous 701088 91287 3756 UnstrandedReadsAssigned:25821787 PositiveStrandReadsAssigned:25729688 NegativeStrandReadsAssigned:1308951 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=106 echo kmer=101 SRR6789276 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789276-trimmed-pair1.fastq SRR6789276-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,770,429 reads, 26,685,104 reads pseudoaligned [quant] estimated average fragment length: 142.294 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR6789276.ke.tsv 35125 SRR6789276.se.tsv 88098 total ==> SRR6789276.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 794.777 0 0 PNS24247 1044 902.706 21.527 1.17776 PNS24249 1928 1786.71 107.668 2.97613 PNS24246 1044 902.706 21.527 1.17776 PNS24248 1044 902.706 21.527 1.17776 PNS24244 1471 1329.71 190.751 7.08484 PNS24243 293 154.612 0 0 KQK14069 1603 1461.71 11014.1 372.143 KQK14071 474 333.385 1491.57 220.961 ==> SRR6789276.se.tsv <== BRADI_1g14170v3 14618 BRADI_1g53295v3 30 BRADI_1g59795v3 1622 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 428 BRADI_1g74790v3 205 BRADI_1g09890v3 0 BRADI_1g77505v3 442 BRADI_1g48960v3 0 SRR6789276 completed mapping pipeline successfully