Starting /dee2/code/volunteer_pipeline.sh SRR6789277 current disk space = 1543036276736 free memory = 1597980632 SRR6789277 SRAfilesize fed2e21b694eb88c9287e424c0b9bddd SRR6789277.sra SRR6789277.sra file validated SRR6789277 is paired end SRR6789277 is conventional basespace SRR6789277 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789277_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7785 33.0 33.0 34.0 32.0 34.0 2 32.76175 34.0 33.0 34.0 32.0 34.0 3 32.82125 34.0 33.0 34.0 32.0 34.0 4 32.394 34.0 33.0 34.0 31.0 34.0 5 32.40625 34.0 33.0 34.0 31.0 34.0 6 35.9955 38.0 36.0 38.0 31.0 38.0 7 36.59575 38.0 37.0 38.0 34.0 38.0 8 36.7805 38.0 38.0 38.0 35.0 38.0 9 36.7845 38.0 38.0 38.0 35.0 38.0 10-11 36.928 38.0 38.0 38.0 35.0 38.0 12-13 36.993125000000006 38.0 38.0 38.0 35.5 38.0 14-15 36.845875 38.0 38.0 38.0 35.5 38.0 16-17 36.906000000000006 38.0 38.0 38.0 35.0 38.0 18-19 36.881375000000006 38.0 38.0 38.0 35.0 38.0 20-21 36.9815 38.0 38.0 38.0 36.0 38.0 22-23 36.856 38.0 38.0 38.0 35.0 38.0 24-25 36.8095 38.0 38.0 38.0 35.0 38.0 26-27 36.8745 38.0 38.0 38.0 35.0 38.0 28-29 36.840374999999995 38.0 38.0 38.0 35.0 38.0 30-31 36.8705 38.0 38.0 38.0 35.0 38.0 32-33 36.896625 38.0 38.0 38.0 35.0 38.0 34-35 36.876625000000004 38.0 38.0 38.0 35.0 38.0 36-37 36.823499999999996 38.0 38.0 38.0 35.0 38.0 38-39 36.59375 38.0 38.0 38.0 34.5 38.0 40-41 36.655249999999995 38.0 38.0 38.0 34.0 38.0 42-43 36.66075 38.0 38.0 38.0 34.0 38.0 44-45 36.44675 38.0 38.0 38.0 33.5 38.0 46-47 36.4925 38.0 38.0 38.0 34.0 38.0 48-49 36.555499999999995 38.0 38.0 38.0 34.0 38.0 50-51 36.619125 38.0 38.0 38.0 34.0 38.0 52-53 36.40525 38.0 38.0 38.0 33.5 38.0 54-55 36.54925 38.0 38.0 38.0 34.0 38.0 56-57 36.406 38.0 38.0 38.0 33.5 38.0 58-59 36.341499999999996 38.0 38.0 38.0 33.5 38.0 60-61 36.304874999999996 38.0 37.5 38.0 33.0 38.0 62-63 36.36875 38.0 38.0 38.0 33.0 38.0 64-65 36.33862499999999 38.0 37.5 38.0 33.0 38.0 66-67 36.167375 38.0 37.0 38.0 32.5 38.0 68-69 36.062250000000006 38.0 37.0 38.0 32.0 38.0 70-71 36.024375 38.0 37.0 38.0 32.0 38.0 72-73 36.146625 38.0 37.0 38.0 33.0 38.0 74-75 36.051249999999996 38.0 37.0 38.0 32.0 38.0 76-77 36.216875 38.0 37.0 38.0 33.0 38.0 78-79 36.131125 38.0 37.0 38.0 33.0 38.0 80-81 36.011125 38.0 37.0 38.0 32.5 38.0 82-83 36.110749999999996 38.0 37.0 38.0 33.0 38.0 84-85 36.085625 38.0 37.0 38.0 33.0 38.0 86-87 36.0295 38.0 37.0 38.0 32.0 38.0 88-89 35.995625000000004 38.0 37.0 38.0 32.5 38.0 90-91 35.86225 38.0 37.0 38.0 31.5 38.0 92-93 35.75375 38.0 36.5 38.0 31.0 38.0 94-95 35.686125000000004 38.0 36.0 38.0 30.5 38.0 96-97 35.585499999999996 38.0 36.0 38.0 31.0 38.0 98-99 35.72075 38.0 36.0 38.0 31.0 38.0 100-101 35.66125 38.0 36.0 38.0 31.0 38.0 102-103 35.474625 38.0 36.0 38.0 30.0 38.0 104-105 35.271125 38.0 35.5 38.0 28.5 38.0 106-107 35.57425 38.0 36.0 38.0 31.0 38.0 108-109 35.49 38.0 36.0 38.0 30.0 38.0 110-111 35.486374999999995 38.0 36.0 38.0 30.0 38.0 112-113 35.136375 38.0 35.0 38.0 28.5 38.0 114-115 35.18275 38.0 35.0 38.0 28.5 38.0 116-117 35.004125 38.0 35.0 38.0 28.0 38.0 118-119 34.783500000000004 38.0 35.0 38.0 26.5 38.0 120-121 35.018125 38.0 35.0 38.0 27.0 38.0 122-123 34.937375 38.0 35.0 38.0 27.0 38.0 124-125 35.040625000000006 38.0 35.0 38.0 27.5 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 5.0 22 2.0 23 9.0 24 10.0 25 14.0 26 29.0 27 28.0 28 58.0 29 53.0 30 72.0 31 87.0 32 108.0 33 153.0 34 221.0 35 285.0 36 587.0 37 2278.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.725 17.9 6.2 33.175 2 24.875 20.025000000000002 33.95 21.15 3 21.025 25.55 27.05 26.375 4 24.75 30.45 23.075000000000003 21.725 5 25.51533433886375 33.03167420814479 20.94017094017094 20.51282051282051 6 21.7 34.300000000000004 21.975 22.025 7 18.875 19.925 38.574999999999996 22.625 8 20.424999999999997 21.4 27.650000000000002 30.525000000000002 9 20.625 20.25 29.825000000000003 29.299999999999997 10-11 25.4375 27.125 21.712500000000002 25.724999999999998 12-13 23.974999999999998 23.0875 24.712500000000002 28.225 14-15 23.4875 24.9 24.7 26.9125 16-17 25.0125 25.674999999999997 23.799999999999997 25.5125 18-19 23.8125 25.525 24.2625 26.400000000000002 20-21 23.97799724965621 25.115639454931866 24.49056132016502 26.415801975246904 22-23 24.087500000000002 25.2625 24.7 25.95 24-25 25.0 24.55 23.5625 26.887499999999996 26-27 24.15 24.3125 25.6 25.937500000000004 28-29 24.725 24.887500000000003 24.1875 26.200000000000003 30-31 23.45 25.474999999999998 24.45 26.625 32-33 24.7 25.7 23.4125 26.187500000000004 34-35 24.69367341835459 25.10627656914228 24.056014003500874 26.144036009002253 36-37 24.6125 24.05 24.175 27.1625 38-39 23.65 25.074999999999996 25.174999999999997 26.1 40-41 24.5125 24.9 24.474999999999998 26.1125 42-43 24.390548818602326 24.590573821727716 24.85310663832979 26.16577072134017 44-45 24.087500000000002 24.887500000000003 24.025 27.0 46-47 24.4375 25.650000000000002 23.525 26.387500000000003 48-49 23.525 25.0 24.7875 26.687499999999996 50-51 24.4875 25.124999999999996 24.224999999999998 26.1625 52-53 24.0375 24.762500000000003 24.15 27.05 54-55 24.50612653163291 23.918479619904975 24.01850462615654 27.556889222305575 56-57 24.2625 25.337500000000002 24.25 26.150000000000002 58-59 24.712500000000002 25.45 23.549999999999997 26.2875 60-61 25.18129532383096 24.06851712928232 23.80595148787197 26.944236059014752 62-63 24.9875 24.8125 24.474999999999998 25.724999999999998 64-65 25.2125 24.3875 24.175 26.224999999999998 66-67 24.025 24.8625 23.875 27.237499999999997 68-69 25.362499999999997 24.762500000000003 23.6125 26.2625 70-71 25.45 24.712500000000002 23.4625 26.375 72-73 25.362499999999997 24.575 23.4125 26.650000000000002 74-75 24.45 24.425 24.2625 26.8625 76-77 25.1875 24.375 24.2375 26.200000000000003 78-79 26.0125 25.224999999999998 23.0 25.7625 80-81 24.6625 25.074999999999996 24.5375 25.724999999999998 82-83 25.3125 24.587500000000002 23.775 26.325 84-85 25.387500000000003 24.65 23.325000000000003 26.637499999999996 86-87 24.5375 25.3 23.4125 26.75 88-89 24.7375 25.3 23.2375 26.724999999999998 90-91 25.7875 25.424999999999997 22.6125 26.174999999999997 92-93 26.0 25.4625 23.225 25.3125 94-95 26.469117279319832 26.65666416604151 21.742935733933482 25.131282820705174 96-97 26.43491309240965 24.85932224584219 22.958609478554457 25.747155183193698 98-99 25.168792198049513 25.468867216804203 22.930732683170792 26.431607901975497 100-101 26.15980992872327 25.459547330248846 22.70851569338502 25.672127047642867 102-103 26.36203866432337 25.407983931709765 23.010293748430833 25.21968365553603 104-105 26.204480040045052 25.52871980978601 22.67550994869228 25.591290201476664 106-107 25.794345759319487 25.73179884913685 21.878909181886414 26.594946209657245 108-109 25.887500000000003 27.237499999999997 20.525 26.35 110-111 25.837500000000002 25.2625 22.237499999999997 26.6625 112-113 26.982531104687695 25.926856855598846 20.97524192534875 26.115370114364712 114-115 26.48315736551031 26.621417797888387 20.82704876822524 26.06837606837607 116-117 25.95448798988622 27.357774968394438 20.910240202275602 25.777496839443742 118-119 26.078184110970998 26.746532156368225 20.84489281210593 26.33039092055485 120-121 26.270337922403 26.107634543178975 20.851063829787233 26.77096370463079 122-123 26.625 26.0625 21.175 26.137500000000003 124-125 24.95 27.0625 21.4375 26.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 0.5 27 2.5 28 5.5 29 7.0 30 7.0 31 8.0 32 15.5 33 25.5 34 32.5 35 42.0 36 52.0 37 61.5 38 79.0 39 104.0 40 117.5 41 137.5 42 160.0 43 153.0 44 144.5 45 153.0 46 158.0 47 157.0 48 156.0 49 156.5 50 147.0 51 123.0 52 107.5 53 98.0 54 93.0 55 99.5 56 103.5 57 105.5 58 111.0 59 98.5 60 95.0 61 88.5 62 79.5 63 88.0 64 83.0 65 76.5 66 75.0 67 67.5 68 60.0 69 58.0 70 48.0 71 39.0 72 30.5 73 22.0 74 22.5 75 17.5 76 10.0 77 6.5 78 4.5 79 3.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0 58-59 0.0 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.025 96-97 0.0375 98-99 0.025 100-101 0.0375 102-103 0.42500000000000004 104-105 0.11249999999999999 106-107 0.075 108-109 0.0 110-111 0.0 112-113 0.5375 114-115 0.5499999999999999 116-117 1.125 118-119 0.8750000000000001 120-121 0.125 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23934677213575 96.25 2 1.4799693799438634 2.9000000000000004 3 0.25516713447307987 0.75 4 0.025516713447307986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0625 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.1875 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.3125 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.48750000000000004 0.0 0.0 0.0 0.0 68-69 0.525 0.0 0.0 0.0 0.0 70-71 0.5875 0.0 0.0 0.0 0.0 72-73 0.8125 0.0 0.0 0.0 0.0 74-75 0.9625 0.0 0.0 0.0 0.0 76-77 1.1375 0.0 0.0 0.0 0.0 78-79 1.4125 0.0 0.0 0.0 0.0 80-81 1.625 0.0 0.0 0.0 0.0 82-83 2.125 0.0 0.0 0.0 0.0 84-85 2.7125 0.0 0.0 0.0 0.0 86-87 3.625 0.0 0.0 0.0 0.0 88-89 4.387499999999999 0.0 0.0 0.0 0.0 90-91 5.0875 0.0 0.0 0.0 0.0 92-93 5.9125 0.0 0.0 0.0 0.0 94-95 7.0125 0.0 0.0 0.0 0.0 96-97 8.05 0.0 0.0 0.0 0.0 98-99 9.1125 0.0 0.0 0.0 0.0 100-101 10.425 0.0 0.0 0.0 0.0 102-103 12.3875 0.0 0.0 0.0 0.0 104-105 14.375 0.0 0.0 0.0 0.0 106-107 16.2875 0.0 0.0 0.0 0.0 108-109 18.2 0.0 0.0 0.0 0.0 110-111 20.075000000000003 0.0 0.0 0.0 0.0 112-113 22.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6789277 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789277_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19675 33.0 33.0 34.0 31.0 34.0 2 32.1225 33.0 33.0 34.0 30.0 34.0 3 32.198 33.0 33.0 34.0 31.0 34.0 4 31.877 33.0 33.0 34.0 30.0 34.0 5 32.07075 33.0 33.0 34.0 31.0 34.0 6 36.0215 38.0 38.0 38.0 31.0 38.0 7 36.1495 38.0 38.0 38.0 33.0 38.0 8 36.06275 38.0 38.0 38.0 33.0 38.0 9 36.174 38.0 38.0 38.0 33.0 38.0 10-11 36.133875 38.0 38.0 38.0 33.0 38.0 12-13 35.852000000000004 38.0 38.0 38.0 31.5 38.0 14-15 35.205875 38.0 37.5 38.0 28.5 38.0 16-17 35.44475 38.0 38.0 38.0 29.0 38.0 18-19 35.687 38.0 38.0 38.0 31.0 38.0 20-21 35.5895 38.0 38.0 38.0 30.0 38.0 22-23 35.576 38.0 37.5 38.0 29.0 38.0 24-25 35.920874999999995 38.0 38.0 38.0 31.0 38.0 26-27 36.089 38.0 38.0 38.0 32.0 38.0 28-29 35.9975 38.0 38.0 38.0 33.0 38.0 30-31 36.166125 38.0 38.0 38.0 33.0 38.0 32-33 35.951625 38.0 38.0 38.0 31.5 38.0 34-35 36.09425 38.0 38.0 38.0 33.0 38.0 36-37 36.09025 38.0 38.0 38.0 33.0 38.0 38-39 36.135 38.0 38.0 38.0 33.0 38.0 40-41 36.094875 38.0 38.0 38.0 33.0 38.0 42-43 35.948375 38.0 38.0 38.0 32.0 38.0 44-45 35.85875 38.0 37.5 38.0 31.5 38.0 46-47 35.768874999999994 38.0 37.5 38.0 30.0 38.0 48-49 35.801125 38.0 37.5 38.0 30.0 38.0 50-51 35.949 38.0 37.5 38.0 31.5 38.0 52-53 36.0015 38.0 37.5 38.0 32.5 38.0 54-55 35.950625 38.0 37.5 38.0 31.5 38.0 56-57 35.805499999999995 38.0 37.5 38.0 31.0 38.0 58-59 35.664125 38.0 37.0 38.0 29.5 38.0 60-61 35.828375 38.0 37.0 38.0 31.0 38.0 62-63 35.904125 38.0 37.5 38.0 31.0 38.0 64-65 35.675625 38.0 37.0 38.0 29.0 38.0 66-67 35.81575 38.0 37.0 38.0 31.0 38.0 68-69 35.496875 38.0 37.0 38.0 29.0 38.0 70-71 35.65075 38.0 37.0 38.0 29.0 38.0 72-73 35.623625000000004 38.0 37.0 38.0 29.5 38.0 74-75 35.654875000000004 38.0 37.0 38.0 29.5 38.0 76-77 35.583625 38.0 37.0 38.0 30.0 38.0 78-79 35.426625 38.0 37.0 38.0 29.0 38.0 80-81 35.448125000000005 38.0 37.0 38.0 29.0 38.0 82-83 35.37175 38.0 37.0 38.0 28.5 38.0 84-85 35.308375 38.0 36.5 38.0 28.5 38.0 86-87 35.290125 38.0 37.0 38.0 29.0 38.0 88-89 35.222750000000005 38.0 36.0 38.0 28.0 38.0 90-91 35.212 38.0 36.5 38.0 28.0 38.0 92-93 35.05325 38.0 36.0 38.0 26.5 38.0 94-95 35.034125 38.0 36.0 38.0 27.0 38.0 96-97 34.79175 38.0 35.5 38.0 24.5 38.0 98-99 34.939375 38.0 36.0 38.0 26.0 38.0 100-101 34.825625 38.0 35.0 38.0 25.5 38.0 102-103 34.739125 38.0 35.0 38.0 25.0 38.0 104-105 34.593125 38.0 35.0 38.0 24.0 38.0 106-107 34.63725 38.0 35.0 38.0 24.0 38.0 108-109 34.52025 38.0 35.0 38.0 23.5 38.0 110-111 34.504 38.0 35.0 38.0 23.0 38.0 112-113 34.3775 38.0 35.0 38.0 23.0 38.0 114-115 34.354375000000005 38.0 34.5 38.0 24.0 38.0 116-117 34.1405 38.0 34.5 38.0 22.0 38.0 118-119 34.16225 38.0 34.0 38.0 23.0 38.0 120-121 33.984625 38.0 34.0 38.0 21.0 38.0 122-123 34.054 38.0 34.0 38.0 22.0 38.0 124-125 34.062875 38.0 34.0 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 6.0 17 9.0 18 12.0 19 15.0 20 10.0 21 12.0 22 16.0 23 27.0 24 29.0 25 35.0 26 44.0 27 52.0 28 51.0 29 52.0 30 72.0 31 97.0 32 116.0 33 170.0 34 189.0 35 287.0 36 509.0 37 2170.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.71722752385736 21.396283274736312 7.257659467604219 28.628829733802107 2 29.871762635152127 20.442544631631883 29.519738496354037 20.165954236861953 3 22.52388134741076 23.95676219205631 27.853192559074913 25.666163901458017 4 24.522132796780685 31.036217303822937 21.378269617706238 23.06338028169014 5 28.00402212166918 33.15736551030668 16.918049270990448 21.920563097033686 6 25.414781297134237 32.47863247863248 18.04927099044746 24.057315233785822 7 24.020100502512562 17.412060301507537 34.2964824120603 24.271356783919597 8 22.160804020100503 20.57788944723618 23.26633165829146 33.994974874371856 9 24.34673366834171 20.477386934673365 25.95477386934673 29.22110552763819 10-11 28.619866884340073 25.88220519904559 19.427351500690694 26.070576415923647 12-13 25.951207179876125 20.566300088484386 24.497535077739858 28.984957653899635 14-15 26.53979683682654 23.093737945223094 23.94239423942394 26.424070978526427 16-17 27.066326530612244 22.729591836734695 23.72448979591837 26.479591836734695 18-19 26.949453898907798 23.291846583693168 24.117348234696472 25.64135128270257 20-21 25.91366356806316 24.449255061759835 24.411053100725837 25.226028269451167 22-23 26.688590943587148 23.53908423981786 24.07032633442955 25.701998482165443 24-25 26.949195171026158 23.478370221327967 23.679577464788732 25.892857142857146 26-27 27.31609339693698 23.92668842580969 23.763494853125785 24.993723324127544 28-29 26.575445643986946 24.165202108963094 24.240522219432588 25.018830027617373 30-31 27.454180266131058 23.56264122520713 23.60030128044188 25.382877228219936 32-33 26.286718553853877 23.98945518453427 23.663068039166458 26.06075822244539 34-35 27.604820487070047 24.35350238513683 22.508159678634197 25.53351744915893 36-37 26.120246014811094 23.710305008158656 24.501066900966485 25.66838207606376 38-39 26.12352498116997 24.077328646748683 23.801154908360534 25.997991463720815 40-41 26.101694915254235 23.79158819836786 25.14752040175769 24.959196484620215 42-43 26.16118503640472 24.340949033391915 24.66733617875973 24.830529751443635 44-45 26.754551161330824 23.69114877589454 23.678593848085374 25.875706214689266 46-47 26.81150320231069 24.073841517016202 23.70965716438528 25.404998116287832 48-49 27.16545317599799 22.784333417022346 25.470750690434347 24.579462716545315 50-51 25.756244508597963 24.789757750721726 24.224927827287562 25.229069913392742 52-53 26.5470064014058 24.413204468432284 23.911133425379692 25.128655704782226 54-55 27.480532529515195 23.86335091685506 23.51168048229088 25.14443607133886 56-57 26.507537688442213 24.309045226130653 23.70603015075377 25.47738693467337 58-59 26.14592490267487 23.885470300138138 24.400351626271505 25.568253170915483 60-61 26.84673366834171 23.467336683417088 24.623115577889447 25.062814070351756 62-63 27.719166038683746 23.72519467470485 23.712635016327553 24.843004270283846 64-65 26.25298329355609 23.753297324456728 25.21040070342922 24.78331867855797 66-67 25.95429432446007 24.5605223505776 24.422400803616274 25.062782521346055 68-69 26.76056338028169 24.044265593561367 24.346076458752517 24.849094567404425 70-71 26.358148893360163 23.18913480885312 24.786217303822937 25.66649899396378 72-73 26.672535211267608 23.340040241448694 25.5658953722334 24.421529175050303 74-75 26.65995975855131 24.4341046277666 24.823943661971832 24.08199195171026 76-77 27.791750503018108 24.19517102615694 23.478370221327967 24.53470824949698 78-79 26.741262257983404 24.013075182298216 24.754840331908472 24.490822227809907 80-81 26.29527162977867 23.3023138832998 24.61016096579477 25.792253521126764 82-83 26.524965413155577 24.261099232800905 24.43717771349516 24.776757640548357 84-85 25.98464829495407 24.663394991820812 24.336227507235435 25.015729205989683 86-87 26.7102615694165 24.32092555331992 24.396378269617706 24.572434607645878 88-89 27.031446540880506 24.51572327044025 24.867924528301888 23.58490566037736 90-91 27.71629778672032 23.591549295774648 24.83651911468813 23.8556338028169 92-93 27.245283018867923 24.61635220125786 24.666666666666668 23.471698113207548 94-95 27.689017486476285 24.908793558938232 23.348848911812805 24.053340042772675 96-97 27.390538500251637 24.949672873678914 23.754403623553095 23.905385002516354 98-99 27.793155510820334 24.609964771011576 23.402113739305484 24.194765978862605 100-101 28.72059378538181 25.18555793181532 22.984023147565733 23.109825135237134 102-103 29.232704402515726 25.295597484276726 22.90566037735849 22.566037735849058 104-105 27.777078877846268 25.1478173355139 24.644609384828282 22.430494401811547 106-107 29.297759879184493 25.169896803423107 22.980115781525296 22.552227535867104 108-109 30.489492890398896 24.751478545363028 22.78847363785076 21.97055492638732 110-111 29.491696024157022 26.648213387015602 22.14393558127831 21.71615500754907 112-113 30.544722606617185 25.764247075103786 22.342433010441564 21.348597307837462 114-115 29.874213836477985 26.0 22.830188679245282 21.29559748427673 116-117 31.177654755913437 24.886763965777554 22.773024660291895 21.16255661801711 118-119 29.852811674424455 26.0158510504466 23.059504340168573 21.071832934960373 120-121 30.77503774534474 25.641670860593862 22.87367891293407 20.709612481127326 122-123 30.708265190590012 25.890049062775194 22.20405082400302 21.197634922631778 124-125 31.57629890552271 25.57554409359668 22.6946785759215 20.153478424959115 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 8.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 2.5 27 2.5 28 4.0 29 6.5 30 5.5 31 5.0 32 8.5 33 13.5 34 26.0 35 39.5 36 44.0 37 46.0 38 60.0 39 76.5 40 99.0 41 126.0 42 142.5 43 152.5 44 150.0 45 151.5 46 158.0 47 161.0 48 157.5 49 137.5 50 135.5 51 143.0 52 115.0 53 106.5 54 115.5 55 100.0 56 98.0 57 110.0 58 106.0 59 98.5 60 95.5 61 95.5 62 101.0 63 93.5 64 80.0 65 78.0 66 82.0 67 75.5 68 62.5 69 59.5 70 59.5 71 51.5 72 39.5 73 26.5 74 25.0 75 21.0 76 9.5 77 9.0 78 6.5 79 2.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.575 3 0.5499999999999999 4 0.6 5 0.5499999999999999 6 0.5499999999999999 7 0.5 8 0.5 9 0.5 10-11 0.46249999999999997 12-13 1.1125 14-15 2.7875 16-17 2.0 18-19 1.575 20-21 1.8375 22-23 1.175 24-25 0.6 26-27 0.42500000000000004 28-29 0.42500000000000004 30-31 0.42500000000000004 32-33 0.42500000000000004 34-35 0.42500000000000004 36-37 0.41250000000000003 38-39 0.42500000000000004 40-41 0.43750000000000006 42-43 0.42500000000000004 44-45 0.43750000000000006 46-47 0.46249999999999997 48-49 0.42500000000000004 50-51 0.41250000000000003 52-53 0.41250000000000003 54-55 0.475 56-57 0.5 58-59 0.46249999999999997 60-61 0.5 62-63 0.475 64-65 0.4875 66-67 0.44999999999999996 68-69 0.6 70-71 0.6 72-73 0.6 74-75 0.6 76-77 0.6 78-79 0.575 80-81 0.6 82-83 0.6125 84-85 0.6625 86-87 0.6 88-89 0.625 90-91 0.6 92-93 0.625 94-95 0.6375 96-97 0.65 98-99 0.65 100-101 0.6375 102-103 0.625 104-105 0.6375 106-107 0.675 108-109 0.6625 110-111 0.65 112-113 0.6375 114-115 0.625 116-117 0.65 118-119 0.6375 120-121 0.65 122-123 0.6375 124-125 0.6375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77986781901372 97.15 2 1.0930350788002035 2.15 3 0.10167768174885612 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02541942043721403 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0625 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.2875 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.4 0.0 0.0 0.0 0.0 66-67 0.5125 0.0 0.0 0.0 0.0 68-69 0.575 0.0 0.0 0.0 0.0 70-71 0.6375 0.0 0.0 0.0 0.0 72-73 0.8625 0.0 0.0 0.0 0.0 74-75 1.0625 0.0 0.0 0.0 0.0 76-77 1.2375 0.0 0.0 0.0 0.0 78-79 1.475 0.0 0.0 0.0 0.0 80-81 1.675 0.0 0.0 0.0 0.0 82-83 2.1624999999999996 0.0 0.0 0.0 0.0 84-85 2.7750000000000004 0.0 0.0 0.0 0.0 86-87 3.675 0.0 0.0 0.0 0.0 88-89 4.4375 0.0 0.0 0.0 0.0 90-91 5.125 0.0 0.0 0.0 0.0 92-93 5.95 0.0 0.0 0.0 0.0 94-95 7.0625 0.0 0.0 0.0 0.0 96-97 8.0875 0.0 0.0 0.0 0.0 98-99 9.125 0.0 0.0 0.0 0.0 100-101 10.4375 0.0 0.0 0.0 0.0 102-103 12.4 0.0 0.0 0.0 0.0 104-105 14.3625 0.0 0.0 0.0 0.0 106-107 16.25 0.0 0.0 0.0 0.0 108-109 18.137500000000003 0.0 0.0 0.0 0.0 110-111 19.9875 0.0 0.0 0.0 0.0 112-113 22.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741979 spots for SRR6789277.sra Written 1741979 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra Read 1741968 spots for SRR6789277.sra Written 1741968 spots for SRR6789277.sra SRR ids: ['SRR6789277.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3wqyhsmj SRR6789277.sra spots: 34839371 blocks: [[1, 1741968], [1741969, 3483936], [3483937, 5225904], [5225905, 6967872], [6967873, 8709840], [8709841, 10451808], [10451809, 12193776], [12193777, 13935744], [13935745, 15677712], [15677713, 17419680], [17419681, 19161648], [19161649, 20903616], [20903617, 22645584], [22645585, 24387552], [24387553, 26129520], [26129521, 27871488], [27871489, 29613456], [29613457, 31355424], [31355425, 33097392], [33097393, 34839371]] SRR6789277 file size 11063438 SRR6789277 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789277 SRR6789277_1.fastq SRR6789277_2.fastq Input file: SRR6789277_1.fastq Paired file: SRR6789277_2.fastq trimmed: SRR6789277-trimmed-pair1.fastq, SRR6789277-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:41:53 2024 >> started Sat Dec 7 12:42:50 2024 >> done (57.051s) 34839371 read pairs processed; of these: 881 ( 0.00%) short read pairs filtered out after trimming by size control 158297 ( 0.45%) empty read pairs filtered out after trimming by size control 34680193 (99.54%) read pairs available; of these: 12341365 (35.59%) trimmed read pairs available after processing 22338828 (64.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 14 0.00% 20 15 0.00% 21 14 0.00% 22 23 0.00% 23 15 0.00% 24 23 0.00% 25 26 0.00% 26 24 0.00% 27 45 0.00% 28 52 0.00% 29 61 0.00% 30 79 0.00% 31 113 0.00% 32 146 0.00% 33 153 0.00% 34 185 0.00% 35 206 0.00% 36 270 0.00% 37 321 0.00% 38 398 0.00% 39 498 0.00% 40 595 0.00% 41 679 0.00% 42 821 0.00% 43 920 0.00% 44 967 0.00% 45 1138 0.00% 46 1344 0.00% 47 1609 0.00% 48 2016 0.01% 49 2411 0.01% 50 2866 0.01% 51 3118 0.01% 52 3711 0.01% 53 3855 0.01% 54 3953 0.01% 55 4475 0.01% 56 4892 0.01% 57 5689 0.02% 58 6527 0.02% 59 7792 0.02% 60 9165 0.03% 61 10529 0.03% 62 12114 0.03% 63 13409 0.04% 64 14313 0.04% 65 15122 0.04% 66 16660 0.05% 67 18133 0.05% 68 20351 0.06% 69 22688 0.07% 70 27546 0.08% 71 32025 0.09% 72 36919 0.11% 73 41093 0.12% 74 43778 0.13% 75 47998 0.14% 76 49766 0.14% 77 52555 0.15% 78 56925 0.16% 79 64953 0.19% 80 74736 0.22% 81 88966 0.26% 82 95885 0.28% 83 105486 0.30% 84 114244 0.33% 85 119907 0.35% 86 123338 0.36% 87 130180 0.38% 88 144117 0.42% 89 147902 0.43% 90 157624 0.45% 91 178402 0.51% 92 194370 0.56% 93 215037 0.62% 94 225621 0.65% 95 231083 0.67% 96 247923 0.71% 97 236005 0.68% 98 235959 0.68% 99 244733 0.71% 100 255641 0.74% 101 276462 0.80% 102 296225 0.85% 103 318180 0.92% 104 330094 0.95% 105 331481 0.96% 106 329394 0.95% 107 318591 0.92% 108 317891 0.92% 109 315669 0.91% 110 318691 0.92% 111 331038 0.95% 112 353374 1.02% 113 366396 1.06% 114 378835 1.09% 115 380702 1.10% 116 368188 1.06% 117 353519 1.02% 118 335733 0.97% 119 330248 0.95% 120 330130 0.95% 121 335611 0.97% 122 344605 0.99% 123 365266 1.05% 124 379755 1.10% 125 22338828 64.41% 34680193 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=25 prefix-density=0.88 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.25 sequence-density-rank=30 fanout-score=12.37 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=4.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=20 prefix-density=0.80 prefix-fanout=2.5 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATTATGATAATTT criterion=fanout-score sequence-density=0.27 sequence-density-rank=20 fanout-score=12.98 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=4.6 sequence=GAGAACCTCTTCGACCAC SRR6789277 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:43:22 Started mapping on | Dec 07 12:43:22 Finished on | Dec 07 12:45:29 Mapping speed, Million of reads per hour | 983.06 Number of input reads | 34680193 Average input read length | 235 UNIQUE READS: Uniquely mapped reads number | 31492480 Uniquely mapped reads % | 90.81% Average mapped length | 234.63 Number of splices: Total | 20721493 Number of splices: Annotated (sjdb) | 19516951 Number of splices: GT/AG | 20433202 Number of splices: GC/AG | 245897 Number of splices: AT/AC | 6538 Number of splices: Non-canonical | 35856 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1339600 % of reads mapped to multiple loci | 3.86% Number of reads mapped to too many loci | 190431 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 2.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1873935 1873935 1873935 N_multimapping 1339600 1339600 1339600 N_noFeature 1410566 29876552 2339353 N_ambiguous 790454 4707 103642 UnstrandedReadsAssigned:29291460 PositiveStrandReadsAssigned:1611221 NegativeStrandReadsAssigned:29049485 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=109 echo kmer=105 SRR6789277 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789277-trimmed-pair1.fastq SRR6789277-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,680,193 reads, 29,602,272 reads pseudoaligned [quant] estimated average fragment length: 149.492 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR6789277.ke.tsv 35125 SRR6789277.se.tsv 88098 total ==> SRR6789277.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 787.589 0 0 PNS24247 1044 895.508 60.1098 3.13436 PNS24249 1928 1779.51 123.801 3.2486 PNS24246 1044 895.508 60.1098 3.13436 PNS24248 1044 895.508 60.1098 3.13436 PNS24244 1471 1322.51 209.87 7.41011 PNS24243 293 149.286 0 0 KQK14069 1603 1454.51 22690.8 728.461 KQK14071 474 326.503 2817.78 402.988 ==> SRR6789277.se.tsv <== BRADI_1g14170v3 29499 BRADI_1g53295v3 36 BRADI_1g59795v3 1779 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 308 BRADI_1g74790v3 231 BRADI_1g09890v3 0 BRADI_1g77505v3 490 BRADI_1g48960v3 0 SRR6789277 completed mapping pipeline successfully