Starting /dee2/code/volunteer_pipeline.sh SRR6789278 current disk space = 1543059685376 free memory = 1606547488 SRR6789278 SRAfilesize 85b4c8d90a47ad8eaab7a87ee93c31d7 SRR6789278.sra SRR6789278.sra file validated SRR6789278 is paired end SRR6789278 is conventional basespace SRR6789278 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789278_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2945 33.0 33.0 34.0 31.0 34.0 2 32.1945 33.0 33.0 34.0 31.0 34.0 3 32.292 33.0 33.0 34.0 31.0 34.0 4 32.0105 33.0 33.0 34.0 31.0 34.0 5 32.152 33.0 33.0 34.0 31.0 34.0 6 36.23625 38.0 38.0 38.0 33.0 38.0 7 36.283 38.0 38.0 38.0 33.0 38.0 8 36.27525 38.0 38.0 38.0 33.0 38.0 9 36.29725 38.0 38.0 38.0 33.0 38.0 10-11 36.30975 38.0 38.0 38.0 33.5 38.0 12-13 36.052375 38.0 38.0 38.0 33.0 38.0 14-15 35.48 38.0 38.0 38.0 30.0 38.0 16-17 35.653875 38.0 38.0 38.0 31.0 38.0 18-19 35.862375 38.0 38.0 38.0 31.0 38.0 20-21 35.692499999999995 38.0 38.0 38.0 31.0 38.0 22-23 35.745875 38.0 38.0 38.0 30.0 38.0 24-25 36.040625 38.0 38.0 38.0 31.5 38.0 26-27 36.234375 38.0 38.0 38.0 33.0 38.0 28-29 36.17575 38.0 38.0 38.0 33.0 38.0 30-31 36.247749999999996 38.0 38.0 38.0 33.5 38.0 32-33 36.186125000000004 38.0 38.0 38.0 33.0 38.0 34-35 36.2325 38.0 38.0 38.0 33.5 38.0 36-37 36.245999999999995 38.0 38.0 38.0 33.5 38.0 38-39 36.242125 38.0 38.0 38.0 33.0 38.0 40-41 36.13875 38.0 38.0 38.0 33.0 38.0 42-43 36.182625 38.0 38.0 38.0 33.0 38.0 44-45 35.992374999999996 38.0 38.0 38.0 32.0 38.0 46-47 35.939 38.0 38.0 38.0 31.5 38.0 48-49 35.980000000000004 38.0 38.0 38.0 31.5 38.0 50-51 35.97087500000001 38.0 38.0 38.0 31.0 38.0 52-53 36.0805 38.0 38.0 38.0 33.0 38.0 54-55 35.99975 38.0 38.0 38.0 32.5 38.0 56-57 35.975375 38.0 38.0 38.0 32.0 38.0 58-59 35.968125 38.0 37.0 38.0 32.5 38.0 60-61 35.991 38.0 37.5 38.0 32.5 38.0 62-63 35.92725 38.0 37.5 38.0 31.0 38.0 64-65 35.912125 38.0 37.0 38.0 31.0 38.0 66-67 35.986875 38.0 37.5 38.0 32.0 38.0 68-69 35.654250000000005 38.0 37.0 38.0 30.0 38.0 70-71 35.801 38.0 37.0 38.0 31.0 38.0 72-73 35.68875 38.0 37.0 38.0 30.0 38.0 74-75 35.766999999999996 38.0 37.0 38.0 30.0 38.0 76-77 35.71325 38.0 37.0 38.0 31.0 38.0 78-79 35.66825 38.0 37.0 38.0 30.5 38.0 80-81 35.614125 38.0 37.0 38.0 30.0 38.0 82-83 35.60525 38.0 37.0 38.0 30.0 38.0 84-85 35.414 38.0 36.5 38.0 28.5 38.0 86-87 35.469 38.0 37.0 38.0 29.0 38.0 88-89 35.42425 38.0 37.0 38.0 29.0 38.0 90-91 35.31125 38.0 36.5 38.0 29.0 38.0 92-93 35.206500000000005 38.0 36.0 38.0 28.0 38.0 94-95 35.0995 38.0 36.0 38.0 27.5 38.0 96-97 35.0065 38.0 36.0 38.0 26.5 38.0 98-99 34.989875 38.0 36.0 38.0 26.5 38.0 100-101 35.028625000000005 38.0 36.0 38.0 27.0 38.0 102-103 34.77725 38.0 35.0 38.0 25.5 38.0 104-105 34.58925 38.0 35.0 38.0 24.5 38.0 106-107 34.582125000000005 38.0 35.0 38.0 23.5 38.0 108-109 34.63575 38.0 35.0 38.0 23.5 38.0 110-111 34.601749999999996 38.0 35.0 38.0 24.0 38.0 112-113 34.369625 38.0 35.0 38.0 23.0 38.0 114-115 34.436499999999995 38.0 35.0 38.0 23.5 38.0 116-117 34.300875000000005 38.0 34.0 38.0 23.0 38.0 118-119 34.197 38.0 34.5 38.0 23.0 38.0 120-121 34.06925 38.0 34.0 38.0 22.0 38.0 122-123 34.161375 38.0 34.0 38.0 23.0 38.0 124-125 34.039625 38.0 34.0 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 2.0 18 11.0 19 12.0 20 15.0 21 12.0 22 23.0 23 20.0 24 22.0 25 25.0 26 41.0 27 56.0 28 42.0 29 65.0 30 90.0 31 79.0 32 119.0 33 150.0 34 195.0 35 272.0 36 543.0 37 2187.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.99698946312092 20.22077270446563 8.404415454089314 29.377822378324137 2 28.636021100226074 21.32629992464205 29.389600602863602 20.648078372268273 3 22.55714644561668 23.9638281838734 28.25923134890731 25.219794021602617 4 24.780095501382256 31.91756722794672 20.005026388539836 23.29731088213119 5 28.71137905048983 31.75081637779452 18.789248932429036 20.74855563928661 6 24.70499623399448 32.48807431584233 19.307054983680644 23.499874466482552 7 21.460843373493976 17.16867469879518 35.76807228915663 25.602409638554217 8 22.710163111668756 20.978670012547052 23.93977415307403 32.37139272271016 9 24.096385542168676 20.15562248995984 24.87449799196787 30.873493975903614 10-11 27.311504202734916 25.46731903148915 19.583490151800277 27.63768661397566 12-13 26.291198383634296 20.444500568253567 25.24308624826367 28.021214799848465 14-15 25.96302003081664 23.805855161787363 24.2552645095018 25.975860297894197 16-17 26.8578712555768 22.957297641810072 23.887826641172722 26.29700446144041 18-19 26.28375808292126 24.191707873716243 23.468999619627233 26.05553442373526 20-21 26.67599542042997 24.16995293219692 23.597506678539627 25.556544968833485 22-23 26.659082290481606 24.53545695866515 23.90342560991025 24.902035140942992 24-25 27.063701470033923 23.82208820203543 23.244126146500815 25.870084181429824 26-27 26.000250846607297 24.08127430076508 24.720933149379153 25.197541703248465 28-29 25.64906559638781 23.88059701492537 24.83381412266399 25.636523266022827 30-31 25.840441545408932 24.234821876567988 23.921224284997493 26.003512293025587 32-33 26.116407425990968 24.498243853487207 23.494731560461616 25.89061716006021 34-35 27.1039759187257 24.3446632384297 23.30364981813621 25.24771102470839 36-37 26.91584096325097 22.939922237551738 24.256866925874828 25.887369873322463 38-39 26.505268439538384 23.99648770697441 24.397892624184646 25.100351229302557 40-41 27.232814851981935 23.858504766683392 23.68289011540391 25.22579026593076 42-43 26.84395383843452 23.432012042147516 24.172102358253888 25.551931761164077 44-45 26.329653788258906 24.29754139488209 24.222277972905168 25.15052684395384 46-47 26.662484316185697 24.2534504391468 24.140526976160604 24.943538268506902 48-49 25.802809834420472 24.435524335173106 24.322629202207725 25.439036628198696 50-51 25.87482754295748 24.846356453028974 24.871441113758934 24.40737489025461 52-53 27.003637275805847 24.093816631130064 24.118901291860027 24.783644801204062 54-55 27.189460476787954 23.29987452948557 24.51693851944793 24.993726474278542 56-57 26.393072289156628 23.393574297188753 24.460341365461847 25.75301204819277 58-59 26.292022077270445 23.707977922729555 24.836929252383342 25.163070747616658 60-61 26.716024595306813 24.01807002133266 24.79608482871126 24.469820554649267 62-63 26.76286072772898 24.49184441656211 23.914680050188206 24.830614805520703 64-65 26.913425345043912 25.04391468005019 24.303638644918443 23.73902132998745 66-67 25.639739086803814 24.109382839939787 24.899648770697443 25.35122930255896 68-69 26.319095477386934 24.14572864321608 23.98241206030151 25.552763819095475 70-71 26.48831951770912 23.775433308214016 24.918362220547603 24.817884953529266 72-73 27.160804020100503 23.63065326633166 24.547738693467338 24.660804020100503 74-75 26.771356783919597 24.309045226130653 24.547738693467338 24.371859296482413 76-77 27.57537688442211 24.334170854271356 23.618090452261306 24.472361809045225 78-79 25.515075376884422 24.987437185929647 24.23366834170854 25.263819095477384 80-81 26.262880120633326 24.993717014325206 24.50364413169138 24.23975873335009 82-83 26.79401784592183 24.996858112353905 24.230237526706045 23.97888651501822 84-85 26.728689967312043 24.60397284385215 24.478249937138546 24.18908725169726 86-87 27.167630057803464 24.79266147273184 23.4606685096758 24.579039959788894 88-89 26.6088486676722 24.522373051784815 24.86173956762192 24.007038712921066 90-91 27.682834883136465 24.17692887660216 23.812515707464186 24.327720532797183 92-93 27.346990071635034 25.32361442754807 23.275103682292322 24.05429181852457 94-95 27.885340709077195 25.471460900176012 23.899924566255972 22.743273824490824 96-97 27.818981772470146 25.065996228786926 23.859208045254558 23.25581395348837 98-99 27.797334674377673 25.584611516218253 23.43474981141564 23.183303997988432 100-101 28.379227964290205 25.33635106249214 24.016094555513643 22.268326417704014 102-103 27.806411062225017 25.908233815210558 23.25581395348837 23.029541169076055 104-105 28.37209302325581 25.56882463859208 23.331238214959146 22.727844123192963 106-107 29.530876619293174 25.11633756760156 23.091435039617657 22.261350773487614 108-109 29.728370221327964 25.930583501006037 21.692655935613683 22.648390342052313 110-111 27.973346743776716 26.86698516469701 23.309026904702037 21.85064118682424 112-113 29.465744814582024 25.757385292269014 22.564424890006286 22.212445003142676 114-115 30.040221216691805 25.540472599296127 22.88838612368024 21.530920060331827 116-117 30.52552175006286 26.037213980387225 22.39124968569273 21.04601458385718 118-119 30.36701860231272 26.520864756158876 21.920563097033686 21.19155354449472 120-121 30.126996102099834 25.084873632591474 23.601156796177545 21.186973469131146 122-123 30.90749120160885 25.703871292106584 22.586726998491706 20.80191050779286 124-125 31.55248271527341 26.147077309868006 21.97360150848523 20.32683846637335 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 6.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 1.0 25 2.0 26 3.0 27 3.5 28 3.5 29 5.0 30 4.5 31 4.0 32 12.5 33 19.0 34 23.5 35 28.5 36 44.5 37 64.5 38 71.0 39 78.0 40 100.0 41 125.5 42 129.0 43 137.0 44 157.5 45 160.0 46 154.0 47 152.5 48 149.5 49 145.0 50 137.5 51 133.5 52 116.5 53 111.0 54 123.0 55 112.0 56 105.0 57 112.5 58 110.5 59 109.5 60 111.5 61 106.0 62 90.0 63 89.0 64 95.0 65 87.5 66 76.0 67 64.0 68 58.5 69 51.5 70 48.5 71 43.5 72 35.0 73 25.5 74 17.5 75 13.0 76 10.5 77 7.0 78 2.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.475 3 0.475 4 0.525 5 0.475 6 0.42500000000000004 7 0.4 8 0.375 9 0.4 10-11 0.36250000000000004 12-13 1.0125 14-15 2.65 16-17 1.9375 18-19 1.4125 20-21 1.7375000000000003 22-23 1.1125 24-25 0.5125000000000001 26-27 0.3375 28-29 0.3375 30-31 0.35000000000000003 32-33 0.35000000000000003 34-35 0.3375 36-37 0.3375 38-39 0.35000000000000003 40-41 0.35000000000000003 42-43 0.35000000000000003 44-45 0.35000000000000003 46-47 0.375 48-49 0.35000000000000003 50-51 0.3375 52-53 0.3375 54-55 0.375 56-57 0.4 58-59 0.35000000000000003 60-61 0.3875 62-63 0.375 64-65 0.375 66-67 0.35000000000000003 68-69 0.5 70-71 0.475 72-73 0.5 74-75 0.5 76-77 0.5 78-79 0.5 80-81 0.525 82-83 0.5375 84-85 0.575 86-87 0.525 88-89 0.5499999999999999 90-91 0.525 92-93 0.5375 94-95 0.575 96-97 0.5625 98-99 0.575 100-101 0.5875 102-103 0.5625 104-105 0.5625 106-107 0.6125 108-109 0.6 110-111 0.575 112-113 0.5625 114-115 0.5499999999999999 116-117 0.575 118-119 0.5499999999999999 120-121 0.5875 122-123 0.5499999999999999 124-125 0.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52116267210607 96.6 2 1.3003569607343193 2.55 3 0.12748597654258031 0.375 4 0.0 0.0 5 0.0 0.0 6 0.025497195308516064 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit CGTCAACCATGGCATTTTGCTTTGCGTTTTTCCTTTCCGGTTTGTTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.23750000000000002 0.0 0.0 0.0 0.0 64-65 0.3875 0.0 0.0 0.0 0.0 66-67 0.5249999999999999 0.0 0.0 0.0 0.0 68-69 0.675 0.0 0.0 0.0 0.0 70-71 0.9125 0.0 0.0 0.0 0.0 72-73 1.2 0.0 0.0 0.0 0.0 74-75 1.525 0.0 0.0 0.0 0.0 76-77 1.8624999999999998 0.0 0.0 0.0 0.0 78-79 2.2125 0.0 0.0 0.0 0.0 80-81 2.5250000000000004 0.0 0.0 0.0 0.0 82-83 3.025 0.0 0.0 0.0 0.0 84-85 3.4625 0.0 0.0 0.0 0.0 86-87 4.125 0.0 0.0 0.0 0.0 88-89 4.9125 0.0 0.0 0.0 0.0 90-91 5.612500000000001 0.0 0.0 0.0 0.0 92-93 6.5125 0.0 0.0 0.0 0.0 94-95 7.8375 0.0 0.0 0.0 0.0 96-97 9.0625 0.0 0.0 0.0 0.0 98-99 10.2 0.0 0.0 0.0 0.0 100-101 11.399999999999999 0.0 0.0 0.0 0.0 102-103 13.05 0.0 0.0 0.0 0.0 104-105 14.625 0.0 0.0 0.0 0.0 106-107 16.125 0.0 0.0 0.0 0.0 108-109 18.05 0.0 0.0 0.0 0.0 110-111 19.95 0.0 0.0 0.0 0.0 112-113 21.637500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6789278 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789278_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.619 33.0 33.0 34.0 32.0 34.0 2 32.6945 34.0 33.0 34.0 31.0 34.0 3 32.716 34.0 33.0 34.0 32.0 34.0 4 32.41 33.0 33.0 34.0 31.0 34.0 5 32.39825 33.0 33.0 34.0 31.0 34.0 6 36.0015 38.0 36.0 38.0 31.0 38.0 7 36.573 38.0 37.0 38.0 34.0 38.0 8 36.80425 38.0 38.0 38.0 35.0 38.0 9 36.8565 38.0 38.0 38.0 35.0 38.0 10-11 36.87975 38.0 38.0 38.0 35.0 38.0 12-13 37.017624999999995 38.0 38.0 38.0 36.0 38.0 14-15 36.879374999999996 38.0 38.0 38.0 35.0 38.0 16-17 36.869375000000005 38.0 38.0 38.0 35.0 38.0 18-19 36.86525 38.0 38.0 38.0 35.0 38.0 20-21 36.93175 38.0 38.0 38.0 35.0 38.0 22-23 36.898624999999996 38.0 38.0 38.0 35.0 38.0 24-25 36.81075 38.0 38.0 38.0 34.5 38.0 26-27 36.789625 38.0 38.0 38.0 35.0 38.0 28-29 36.812375 38.0 38.0 38.0 35.0 38.0 30-31 36.908 38.0 38.0 38.0 35.0 38.0 32-33 36.866 38.0 38.0 38.0 35.0 38.0 34-35 36.79625 38.0 38.0 38.0 35.0 38.0 36-37 36.6945 38.0 38.0 38.0 34.0 38.0 38-39 36.551625 38.0 38.0 38.0 34.0 38.0 40-41 36.495625000000004 38.0 38.0 38.0 34.0 38.0 42-43 36.407125 38.0 38.0 38.0 33.5 38.0 44-45 36.315875000000005 38.0 38.0 38.0 33.0 38.0 46-47 36.411874999999995 38.0 38.0 38.0 33.5 38.0 48-49 36.50475 38.0 38.0 38.0 34.0 38.0 50-51 36.44425 38.0 38.0 38.0 33.5 38.0 52-53 36.253 38.0 37.0 38.0 32.5 38.0 54-55 36.310249999999996 38.0 38.0 38.0 33.0 38.0 56-57 36.290875 38.0 37.0 38.0 33.0 38.0 58-59 36.241125 38.0 37.0 38.0 33.0 38.0 60-61 36.208124999999995 38.0 37.0 38.0 33.0 38.0 62-63 36.225875 38.0 37.0 38.0 33.0 38.0 64-65 36.1435 38.0 37.0 38.0 33.0 38.0 66-67 36.1165 38.0 37.0 38.0 33.0 38.0 68-69 36.172625 38.0 37.0 38.0 33.0 38.0 70-71 36.059250000000006 38.0 37.0 38.0 32.0 38.0 72-73 36.207875 38.0 37.0 38.0 33.0 38.0 74-75 36.082375 38.0 37.0 38.0 32.5 38.0 76-77 36.20325 38.0 37.0 38.0 33.0 38.0 78-79 36.13225 38.0 37.0 38.0 33.0 38.0 80-81 36.062875000000005 38.0 37.0 38.0 32.0 38.0 82-83 35.991749999999996 38.0 37.0 38.0 32.0 38.0 84-85 36.080625 38.0 37.0 38.0 32.5 38.0 86-87 35.915375 38.0 37.0 38.0 32.0 38.0 88-89 35.823625 38.0 37.0 38.0 31.0 38.0 90-91 35.748875 38.0 36.0 38.0 31.0 38.0 92-93 35.594375 38.0 36.0 38.0 30.0 38.0 94-95 35.69 38.0 36.0 38.0 31.0 38.0 96-97 35.588 38.0 36.0 38.0 30.5 38.0 98-99 35.6475 38.0 36.0 38.0 30.0 38.0 100-101 35.585875 38.0 36.0 38.0 31.0 38.0 102-103 35.48975 38.0 36.0 38.0 30.0 38.0 104-105 35.271 38.0 36.0 38.0 28.5 38.0 106-107 35.226375000000004 38.0 35.5 38.0 28.5 38.0 108-109 35.25575 38.0 35.5 38.0 28.5 38.0 110-111 35.32875 38.0 35.0 38.0 28.5 38.0 112-113 35.000875 38.0 35.0 38.0 28.0 38.0 114-115 34.943875000000006 38.0 35.0 38.0 27.5 38.0 116-117 34.90575 38.0 35.0 38.0 27.0 38.0 118-119 34.752875 38.0 35.0 38.0 26.5 38.0 120-121 34.775625 38.0 35.0 38.0 25.5 38.0 122-123 34.86625 38.0 35.0 38.0 27.0 38.0 124-125 34.815250000000006 38.0 35.0 38.0 27.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 14.0 24 20.0 25 21.0 26 24.0 27 31.0 28 42.0 29 52.0 30 62.0 31 93.0 32 117.0 33 170.0 34 213.0 35 303.0 36 670.0 37 2160.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.025 17.0 6.950000000000001 34.025 2 24.25 18.2 34.275 23.275000000000002 3 20.655163790947736 24.5311327831958 27.981995498874717 26.831707926981746 4 25.424999999999997 28.025 24.725 21.825 5 24.547738693467338 32.48743718592964 22.512562814070353 20.452261306532662 6 21.875 32.525 23.325000000000003 22.275 7 19.55 20.3 37.525 22.625 8 19.975 21.45 27.975 30.599999999999998 9 20.125 19.725 31.674999999999997 28.475 10-11 24.95 28.000000000000004 20.1875 26.8625 12-13 24.1125 22.4375 25.575 27.875 14-15 23.8625 24.2625 24.5125 27.3625 16-17 24.45 25.650000000000002 23.775 26.125 18-19 24.125 25.424999999999997 24.425 26.025 20-21 24.815601950243778 25.84073009126141 24.715589448681087 24.62807850981373 22-23 24.4125 25.412499999999998 24.375 25.8 24-25 24.087500000000002 24.9125 24.275 26.724999999999998 26-27 23.1875 25.1 25.324999999999996 26.387500000000003 28-29 23.9875 25.7875 24.4875 25.7375 30-31 23.7 25.337500000000002 24.8625 26.1 32-33 24.099999999999998 25.4375 24.4875 25.974999999999998 34-35 24.934350381393024 24.134050268850817 24.14655495810929 26.785044391646867 36-37 24.349999999999998 25.2 24.1375 26.3125 38-39 24.637500000000003 24.1625 25.6 25.6 40-41 24.175 24.7875 24.775 26.2625 42-43 24.453056632079008 25.065633204150515 24.74059257407176 25.740717589698715 44-45 24.675 24.4875 24.4 26.437500000000004 46-47 24.637500000000003 25.174999999999997 24.5 25.687500000000004 48-49 23.974999999999998 24.9375 24.9125 26.174999999999997 50-51 24.375 25.1875 23.8125 26.625 52-53 23.775 25.900000000000002 24.425 25.900000000000002 54-55 24.093523380845213 24.918729682420604 24.031007751937985 26.9567391847962 56-57 23.7625 24.8625 25.0125 26.3625 58-59 24.925 24.7375 24.425 25.912499999999998 60-61 25.05939727397774 24.471676878829562 23.87145179442291 26.597474052769787 62-63 24.95 25.05 23.5 26.5 64-65 24.425 26.474999999999998 23.3375 25.7625 66-67 24.6125 24.1125 24.1375 27.1375 68-69 24.637500000000003 24.7 24.1625 26.5 70-71 24.837500000000002 24.0625 23.8625 27.237499999999997 72-73 25.337500000000002 24.325 23.6625 26.674999999999997 74-75 24.3125 25.387500000000003 24.837500000000002 25.4625 76-77 25.2 24.9 23.925 25.974999999999998 78-79 24.4 25.362499999999997 23.2125 27.025 80-81 24.1875 24.9125 24.175 26.724999999999998 82-83 25.387500000000003 24.875 24.125 25.6125 84-85 25.650000000000002 24.6625 24.2625 25.424999999999997 86-87 25.074999999999996 25.162499999999998 22.9875 26.775 88-89 25.662499999999998 25.074999999999996 23.8125 25.45 90-91 25.275 25.424999999999997 23.599999999999998 25.7 92-93 25.924999999999997 25.324999999999996 23.4875 25.2625 94-95 25.57208953357509 25.472052019507313 23.42128298111792 25.534575465799676 96-97 25.53776888444222 25.50025012506253 22.861430715357677 26.100550275137568 98-99 25.684631736901338 24.746780042515944 23.458797048893334 26.109791171689384 100-101 25.64102564102564 26.841776110068793 22.026266416510317 25.490931832395248 102-103 26.06623181133969 25.627195183140994 22.06472654290015 26.24184646261917 104-105 25.89162808159179 26.85521211362783 22.36265799023902 24.89050181454136 106-107 25.67854909318324 25.64102564102564 22.138836772983115 26.541588492808003 108-109 26.6125 26.2625 21.4875 25.637500000000003 110-111 25.724999999999998 26.924999999999997 21.9 25.45 112-113 25.602712204922152 26.255650426921147 22.13711702661979 26.004520341536917 114-115 27.158634538152608 26.142068273092367 20.94628514056225 25.75301204819277 116-117 25.44125063035804 27.09278870398386 21.02874432677761 26.437216338880482 118-119 25.125881168177237 26.661631419939575 21.487915407854985 26.724572004028197 120-121 25.472288252220693 25.672463405479796 20.918303515576127 27.93694482672338 122-123 25.4875 25.674999999999997 21.762500000000003 27.075 124-125 26.1125 26.924999999999997 20.875 26.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.0 25 1.5 26 2.0 27 2.0 28 4.5 29 5.5 30 7.0 31 9.5 32 14.0 33 20.5 34 34.0 35 45.5 36 53.0 37 65.0 38 75.0 39 100.5 40 130.5 41 147.5 42 151.0 43 153.0 44 159.5 45 170.0 46 161.5 47 142.0 48 143.0 49 141.0 50 138.5 51 131.5 52 116.5 53 102.5 54 101.0 55 112.5 56 120.5 57 111.5 58 95.0 59 94.5 60 94.0 61 91.0 62 96.0 63 84.5 64 68.0 65 67.5 66 66.5 67 66.5 68 65.0 69 55.5 70 39.5 71 28.5 72 29.5 73 24.0 74 17.5 75 14.0 76 10.0 77 7.0 78 5.0 79 3.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0375 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0 58-59 0.0 60-61 0.0375 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0375 96-97 0.05 98-99 0.0375 100-101 0.0625 102-103 0.35000000000000003 104-105 0.11249999999999999 106-107 0.0625 108-109 0.0 110-111 0.0 112-113 0.44999999999999996 114-115 0.4 116-117 0.8500000000000001 118-119 0.7000000000000001 120-121 0.08750000000000001 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.5295934122491 94.75 2 2.110138960370561 4.1000000000000005 3 0.28306742151312403 0.8250000000000001 4 0.0514668039114771 0.2 5 0.02573340195573855 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.23750000000000002 0.0 0.0 0.0 0.0 64-65 0.3875 0.0 0.0 0.0 0.0 66-67 0.5249999999999999 0.0 0.0 0.0 0.0 68-69 0.65 0.0 0.0 0.0 0.0 70-71 0.8875 0.0 0.0 0.0 0.0 72-73 1.1625 0.0 0.0 0.0 0.0 74-75 1.5 0.0 0.0 0.0 0.0 76-77 1.8250000000000002 0.0 0.0 0.0 0.0 78-79 2.2 0.0 0.0 0.0 0.0 80-81 2.5375 0.0 0.0 0.0 0.0 82-83 3.05 0.0 0.0 0.0 0.0 84-85 3.5125 0.0 0.0 0.0 0.0 86-87 4.225 0.0 0.0 0.0 0.0 88-89 5.0375 0.0 0.0 0.0 0.0 90-91 5.775 0.0 0.0 0.0 0.0 92-93 6.65 0.0 0.0 0.0 0.0 94-95 7.9625 0.0 0.0 0.0 0.0 96-97 9.1875 0.0 0.0 0.0 0.0 98-99 10.3 0.0 0.0 0.0 0.0 100-101 11.524999999999999 0.0 0.0 0.0 0.0 102-103 13.3125 0.0 0.0 0.0 0.0 104-105 15.0125 0.0 0.0 0.0 0.0 106-107 16.4875 0.0 0.0 0.0 0.0 108-109 18.5 0.0 0.0 0.0 0.0 110-111 20.4 0.0 0.0 0.0 0.0 112-113 21.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643130 spots for SRR6789278.sra Written 1643130 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra Read 1643120 spots for SRR6789278.sra Written 1643120 spots for SRR6789278.sra SRR ids: ['SRR6789278.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_df2vj0kf SRR6789278.sra spots: 32862410 blocks: [[1, 1643120], [1643121, 3286240], [3286241, 4929360], [4929361, 6572480], [6572481, 8215600], [8215601, 9858720], [9858721, 11501840], [11501841, 13144960], [13144961, 14788080], [14788081, 16431200], [16431201, 18074320], [18074321, 19717440], [19717441, 21360560], [21360561, 23003680], [23003681, 24646800], [24646801, 26289920], [26289921, 27933040], [27933041, 29576160], [29576161, 31219280], [31219281, 32862410]] SRR6789278 file size 10435028 SRR6789278 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789278 SRR6789278_1.fastq SRR6789278_2.fastq Input file: SRR6789278_1.fastq Paired file: SRR6789278_2.fastq trimmed: SRR6789278-trimmed-pair1.fastq, SRR6789278-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:43:28 2024 >> started Sat Dec 7 12:44:32 2024 >> done (64.049s) 32862410 read pairs processed; of these: 106 ( 0.00%) short read pairs filtered out after trimming by size control 84763 ( 0.26%) empty read pairs filtered out after trimming by size control 32777541 (99.74%) read pairs available; of these: 4592210 (14.01%) trimmed read pairs available after processing 28185331 (85.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 751 0.00% 76 0 0.00% 77 136 0.00% 78 0 0.00% 79 21 0.00% 80 14 0.00% 81 5875 0.02% 82 727 0.00% 83 504 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 2197 0.01% 88 11095 0.03% 89 6350 0.02% 90 186 0.00% 91 2354 0.01% 92 361 0.00% 93 2017 0.01% 94 685 0.00% 95 2019 0.01% 96 22367 0.07% 97 2810 0.01% 98 1652 0.01% 99 2777 0.01% 100 1022 0.00% 101 3013 0.01% 102 15 0.00% 103 0 0.00% 104 302 0.00% 105 2809 0.01% 106 483 0.00% 107 436 0.00% 108 4250 0.01% 109 530 0.00% 110 4594 0.01% 111 40013 0.12% 112 338342 1.03% 113 351183 1.07% 114 363613 1.11% 115 367075 1.12% 116 352800 1.08% 117 336584 1.03% 118 322402 0.98% 119 316709 0.97% 120 318024 0.97% 121 320812 0.98% 122 329841 1.01% 123 358224 1.09% 124 394236 1.20% 125 28185331 85.99% 32777541 reads passed initial QC criterion=sequence-density sequence-density=21.16 sequence-density-rank=1 fanout-score=40.94 fanout-score-rank=1 prefix-density=21.42 prefix-fanout=40.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=fanout-score sequence-density=21.16 sequence-density-rank=1 fanout-score=40.94 fanout-score-rank=1 prefix-density=21.42 prefix-fanout=40.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=sequence-density sequence-density=21.12 sequence-density-rank=1 fanout-score=41.13 fanout-score-rank=1 prefix-density=21.24 prefix-fanout=40.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=21.12 sequence-density-rank=1 fanout-score=41.13 fanout-score-rank=1 prefix-density=21.24 prefix-fanout=40.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA -y AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR6789278 SRR6789278_1.fastq SRR6789278_2.fastq Input file: SRR6789278_1.fastq Paired file: SRR6789278_2.fastq trimmed: SRR6789278-trimmed-pair1.fastq, SRR6789278-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:47:14 2024 >> started Sat Dec 7 12:47:59 2024 >> done (44.242s) 29797765 read pairs processed; of these: 645 ( 0.00%) short read pairs filtered out after trimming by size control 16279 ( 0.05%) empty read pairs filtered out after trimming by size control 29780841 (99.94%) read pairs available; of these: 6617485 (22.22%) trimmed read pairs available after processing 23163356 (77.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 25 0.00% 20 12 0.00% 21 19 0.00% 22 25 0.00% 23 12 0.00% 24 26 0.00% 25 137 0.00% 26 36 0.00% 27 30 0.00% 28 52 0.00% 29 43 0.00% 30 58 0.00% 31 99 0.00% 32 117 0.00% 33 153 0.00% 34 174 0.00% 35 213 0.00% 36 1082 0.00% 37 356 0.00% 38 443 0.00% 39 419 0.00% 40 505 0.00% 41 660 0.00% 42 670 0.00% 43 734 0.00% 44 835 0.00% 45 1049 0.00% 46 1141 0.00% 47 1390 0.00% 48 1714 0.01% 49 2217 0.01% 50 2533 0.01% 51 3007 0.01% 52 3145 0.01% 53 3378 0.01% 54 3492 0.01% 55 3962 0.01% 56 4166 0.01% 57 4918 0.02% 58 5601 0.02% 59 6512 0.02% 60 8078 0.03% 61 9211 0.03% 62 10542 0.04% 63 11516 0.04% 64 12188 0.04% 65 12784 0.04% 66 13912 0.05% 67 15296 0.05% 68 17311 0.06% 69 19773 0.07% 70 23304 0.08% 71 27297 0.09% 72 31334 0.11% 73 34941 0.12% 74 37008 0.12% 75 40785 0.14% 76 42140 0.14% 77 45381 0.15% 78 49177 0.17% 79 55570 0.19% 80 62944 0.21% 81 76521 0.26% 82 82253 0.28% 83 90594 0.30% 84 98300 0.33% 85 103370 0.35% 86 107730 0.36% 87 112383 0.38% 88 127221 0.43% 89 130564 0.44% 90 137477 0.46% 91 155911 0.52% 92 167891 0.56% 93 186549 0.63% 94 196142 0.66% 95 203064 0.68% 96 223314 0.75% 97 209529 0.70% 98 207502 0.70% 99 215223 0.72% 100 223117 0.75% 101 240809 0.81% 102 258218 0.87% 103 274922 0.92% 104 285605 0.96% 105 287091 0.96% 106 286662 0.96% 107 279770 0.94% 108 278544 0.94% 109 276451 0.93% 110 278631 0.94% 111 288830 0.97% 112 307360 1.03% 113 319154 1.07% 114 330467 1.11% 115 333661 1.12% 116 320470 1.08% 117 305718 1.03% 118 292927 0.98% 119 288212 0.97% 120 289332 0.97% 121 291506 0.98% 122 299698 1.01% 123 325549 1.09% 124 357511 1.20% 125 18993412 63.78% criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=16 prefix-density=0.94 prefix-fanout=2.6 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATTATGATAATTTAC criterion=fanout-score sequence-density=0.28 sequence-density-rank=21 fanout-score=13.14 fanout-score-rank=1 prefix-density=1.26 prefix-fanout=2.9 sequence=CATGTTCGGGTTCTTCGT criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=20 prefix-density=0.93 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.29 sequence-density-rank=24 fanout-score=11.40 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA SRR6789278 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:48:44 Started mapping on | Dec 07 12:48:44 Finished on | Dec 07 12:50:50 Mapping speed, Million of reads per hour | 936.02 Number of input reads | 32760617 Average input read length | 236 UNIQUE READS: Uniquely mapped reads number | 28724926 Uniquely mapped reads % | 87.68% Average mapped length | 234.97 Number of splices: Total | 18358491 Number of splices: Annotated (sjdb) | 17289066 Number of splices: GT/AG | 18104037 Number of splices: GC/AG | 214894 Number of splices: AT/AC | 5532 Number of splices: Non-canonical | 34028 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.70 Insertion rate per base | 0.01% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1566671 % of reads mapped to multiple loci | 4.78% Number of reads mapped to too many loci | 244760 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 2.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2481694 2481694 2481694 N_multimapping 1566671 1566671 1566671 N_noFeature 1352627 2242739 27208038 N_ambiguous 724091 97206 4511 UnstrandedReadsAssigned:26648208 PositiveStrandReadsAssigned:26384981 NegativeStrandReadsAssigned:1512377 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=109 echo kmer=105 SRR6789278 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789278-trimmed-pair1.fastq SRR6789278-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,760,617 reads, 27,250,055 reads pseudoaligned [quant] estimated average fragment length: 148.587 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR6789278.ke.tsv 35125 SRR6789278.se.tsv 88098 total ==> SRR6789278.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 788.469 0 0 PNS24247 1044 896.413 53.6361 2.96565 PNS24249 1928 1780.41 111.269 3.09759 PNS24246 1044 896.413 53.6361 2.96565 PNS24248 1044 896.413 53.6361 2.96565 PNS24244 1471 1323.41 179.823 6.73471 PNS24243 293 150.067 1 0.330282 KQK14069 1603 1455.41 16912.5 575.959 KQK14071 474 327.366 2012.93 304.766 ==> SRR6789278.se.tsv <== BRADI_1g14170v3 22326 BRADI_1g53295v3 32 BRADI_1g59795v3 1715 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 252 BRADI_1g74790v3 157 BRADI_1g09890v3 0 BRADI_1g77505v3 463 BRADI_1g48960v3 0 SRR6789278 completed mapping pipeline successfully