Starting /dee2/code/volunteer_pipeline.sh SRR6789279 current disk space = 1543112421376 free memory = 1598093868 SRR6789279 SRAfilesize d6c56a29253b9e72c3e38c890b0ec9f8 SRR6789279.sra SRR6789279.sra file validated SRR6789279 is paired end SRR6789279 is conventional basespace SRR6789279 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789279_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.838 34.0 33.0 34.0 32.0 34.0 2 32.73975 34.0 33.0 34.0 32.0 34.0 3 32.826 34.0 33.0 34.0 32.0 34.0 4 32.51775 34.0 33.0 34.0 31.0 34.0 5 32.51575 34.0 33.0 34.0 31.0 34.0 6 35.982 38.0 36.0 38.0 31.0 38.0 7 36.6235 38.0 37.0 38.0 34.0 38.0 8 36.79175 38.0 38.0 38.0 35.0 38.0 9 36.881 38.0 38.0 38.0 35.0 38.0 10-11 36.96575 38.0 38.0 38.0 35.0 38.0 12-13 36.991375000000005 38.0 38.0 38.0 35.5 38.0 14-15 36.962374999999994 38.0 38.0 38.0 35.5 38.0 16-17 36.946749999999994 38.0 38.0 38.0 35.0 38.0 18-19 37.025499999999994 38.0 38.0 38.0 36.0 38.0 20-21 37.003 38.0 38.0 38.0 35.5 38.0 22-23 36.888374999999996 38.0 38.0 38.0 35.0 38.0 24-25 36.769875 38.0 38.0 38.0 34.5 38.0 26-27 36.856375 38.0 38.0 38.0 35.0 38.0 28-29 36.95525 38.0 38.0 38.0 35.0 38.0 30-31 36.88975000000001 38.0 38.0 38.0 35.0 38.0 32-33 36.890375000000006 38.0 38.0 38.0 35.0 38.0 34-35 36.90712499999999 38.0 38.0 38.0 35.0 38.0 36-37 36.741125 38.0 38.0 38.0 34.5 38.0 38-39 36.624875 38.0 38.0 38.0 34.0 38.0 40-41 36.63675 38.0 38.0 38.0 34.0 38.0 42-43 36.469750000000005 38.0 38.0 38.0 34.0 38.0 44-45 36.427625 38.0 38.0 38.0 33.5 38.0 46-47 36.51675 38.0 38.0 38.0 34.0 38.0 48-49 36.658125 38.0 38.0 38.0 34.0 38.0 50-51 36.608375 38.0 38.0 38.0 34.0 38.0 52-53 36.49275 38.0 38.0 38.0 34.0 38.0 54-55 36.570499999999996 38.0 38.0 38.0 34.0 38.0 56-57 36.416250000000005 38.0 38.0 38.0 33.5 38.0 58-59 36.31125 38.0 38.0 38.0 33.0 38.0 60-61 36.372375 38.0 38.0 38.0 33.5 38.0 62-63 36.408 38.0 38.0 38.0 33.5 38.0 64-65 36.3345 38.0 38.0 38.0 33.5 38.0 66-67 36.196375 38.0 37.0 38.0 33.0 38.0 68-69 36.201875 38.0 37.5 38.0 33.0 38.0 70-71 36.011624999999995 38.0 37.0 38.0 32.0 38.0 72-73 36.270875000000004 38.0 37.0 38.0 33.0 38.0 74-75 36.133750000000006 38.0 37.0 38.0 32.5 38.0 76-77 36.2795 38.0 37.0 38.0 33.0 38.0 78-79 36.21375 38.0 37.0 38.0 33.0 38.0 80-81 36.1945 38.0 37.0 38.0 33.0 38.0 82-83 36.219875 38.0 37.0 38.0 33.0 38.0 84-85 36.25 38.0 37.0 38.0 33.0 38.0 86-87 36.157250000000005 38.0 37.0 38.0 33.0 38.0 88-89 36.043499999999995 38.0 37.0 38.0 33.0 38.0 90-91 35.987375 38.0 37.0 38.0 32.0 38.0 92-93 35.686375 38.0 36.5 38.0 31.0 38.0 94-95 35.84875 38.0 36.5 38.0 31.5 38.0 96-97 35.735375 38.0 36.5 38.0 31.0 38.0 98-99 35.7555 38.0 36.0 38.0 31.0 38.0 100-101 35.82225 38.0 36.5 38.0 31.5 38.0 102-103 35.579125000000005 38.0 36.0 38.0 30.0 38.0 104-105 35.465500000000006 38.0 36.0 38.0 29.0 38.0 106-107 35.58425 38.0 36.0 38.0 31.0 38.0 108-109 35.507875 38.0 36.0 38.0 30.0 38.0 110-111 35.626999999999995 38.0 36.0 38.0 31.0 38.0 112-113 35.167249999999996 38.0 36.0 38.0 28.5 38.0 114-115 35.191375 38.0 36.0 38.0 27.5 38.0 116-117 35.039 38.0 35.0 38.0 28.0 38.0 118-119 34.796125 38.0 35.0 38.0 27.0 38.0 120-121 35.146 38.0 35.0 38.0 28.0 38.0 122-123 35.109875 38.0 35.0 38.0 27.5 38.0 124-125 35.232 38.0 35.0 38.0 28.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 13.0 24 10.0 25 15.0 26 20.0 27 38.0 28 38.0 29 57.0 30 68.0 31 96.0 32 99.0 33 155.0 34 207.0 35 298.0 36 526.0 37 2355.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.425 15.9 6.9 37.775 2 23.799999999999997 18.05 35.575 22.575 3 19.650000000000002 25.275 27.625 27.450000000000003 4 25.15 30.0 22.375 22.475 5 24.817334341143866 32.62786596119929 22.19702695893172 20.357772738725117 6 22.525000000000002 33.074999999999996 22.25 22.15 7 18.8 20.45 39.25 21.5 8 20.150000000000002 21.15 26.8 31.900000000000002 9 21.099999999999998 20.474999999999998 30.2 28.225 10-11 24.2625 29.9 20.4375 25.4 12-13 23.95 23.0 25.124999999999996 27.925 14-15 23.375 25.0 25.8625 25.7625 16-17 23.8625 24.575 25.15 26.4125 18-19 24.462500000000002 25.224999999999998 24.675 25.637500000000003 20-21 24.212500000000002 25.9625 24.6 25.224999999999998 22-23 24.1625 25.8125 24.4875 25.5375 24-25 24.0 25.15 24.4 26.450000000000003 26-27 23.4375 25.2625 25.0375 26.2625 28-29 24.8625 24.4125 24.8125 25.912499999999998 30-31 24.275 25.4 24.2375 26.087500000000002 32-33 23.974999999999998 25.05 24.1875 26.787499999999998 34-35 24.515564445555693 24.715589448681087 24.40305038129766 26.365795724465556 36-37 23.474999999999998 24.8 24.8125 26.9125 38-39 23.95 24.375 25.0 26.674999999999997 40-41 23.9125 25.424999999999997 24.45 26.2125 42-43 24.45 25.6125 24.4125 25.525 44-45 24.837500000000002 25.3125 24.325 25.525 46-47 24.337500000000002 26.087500000000002 23.05 26.525 48-49 23.599999999999998 24.6 24.2375 27.5625 50-51 23.549999999999997 25.025 24.087500000000002 27.3375 52-53 24.05 25.424999999999997 24.375 26.150000000000002 54-55 24.9875 24.6125 24.575 25.825 56-57 23.8875 24.6125 24.4875 27.0125 58-59 24.8125 25.224999999999998 24.337500000000002 25.624999999999996 60-61 24.2375 24.8625 23.9125 26.987499999999997 62-63 24.1875 24.4125 25.174999999999997 26.224999999999998 64-65 24.8625 25.0375 23.5 26.6 66-67 23.974999999999998 24.762500000000003 24.1375 27.125 68-69 24.6625 25.3125 23.8875 26.137500000000003 70-71 24.1125 25.8 23.325000000000003 26.7625 72-73 25.45 25.75 22.787499999999998 26.0125 74-75 24.725 24.9 23.8875 26.487500000000004 76-77 24.825 24.4875 24.275 26.4125 78-79 25.35 24.675 23.5375 26.437500000000004 80-81 25.7125 25.087500000000002 23.3625 25.837500000000002 82-83 24.462500000000002 25.025 24.425 26.087500000000002 84-85 25.900000000000002 25.6 23.1625 25.337500000000002 86-87 25.837500000000002 24.7 24.0625 25.4 88-89 24.4875 24.8125 24.587500000000002 26.1125 90-91 25.825 24.75 23.75 25.674999999999997 92-93 26.3125 25.025 22.75 25.912499999999998 94-95 25.403175396924617 25.17814726840855 23.052881610201275 26.365795724465556 96-97 25.790723840480062 26.103262907863485 21.852731591448933 26.253281660207527 98-99 25.50318789848731 24.6530816352044 24.065508188523566 25.778222277784725 100-101 25.9625 25.525 23.0625 25.45 102-103 25.36695521264584 25.454773554133737 22.519131852967007 26.659139380253414 104-105 25.50025012506253 26.138069034517258 22.411205602801402 25.950475237618807 106-107 26.522445917218956 25.797173940227587 22.095785919719894 25.584594222833562 108-109 25.087500000000002 26.375 21.9375 26.6 110-111 27.0875 25.275 21.45 26.187500000000004 112-113 25.69060773480663 26.531893520843795 22.06177800100452 25.715720743345056 114-115 26.067302862882975 26.971371170266195 20.994475138121548 25.96685082872928 116-117 25.73807721423164 26.09134494070149 21.57456472369417 26.596013121372696 118-119 25.645222208233665 26.765705652776028 21.125519325191995 26.463552813798312 120-121 25.61601000625391 27.166979362101312 20.913070669168228 26.303939962476548 122-123 25.6 26.5 20.9125 26.987499999999997 124-125 25.275 25.887500000000003 20.9125 27.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 2.5 27 3.0 28 2.0 29 6.0 30 10.0 31 14.0 32 16.5 33 19.0 34 28.5 35 48.0 36 61.0 37 68.0 38 81.5 39 106.5 40 120.0 41 128.5 42 149.0 43 163.5 44 159.0 45 151.0 46 152.5 47 156.5 48 144.5 49 124.0 50 119.0 51 123.5 52 121.0 53 117.5 54 111.0 55 114.5 56 131.5 57 127.5 58 112.0 59 102.0 60 102.0 61 85.5 62 76.5 63 86.5 64 82.5 65 66.5 66 63.0 67 65.0 68 63.5 69 53.0 70 43.0 71 38.5 72 25.5 73 18.0 74 13.0 75 11.5 76 8.0 77 2.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.775 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0125 96-97 0.0125 98-99 0.0125 100-101 0.0 102-103 0.36250000000000004 104-105 0.05 106-107 0.0375 108-109 0.0 110-111 0.0 112-113 0.44999999999999996 114-115 0.44999999999999996 116-117 0.9249999999999999 118-119 0.7125 120-121 0.0625 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.04433497536947 93.575 2 2.411200414830179 4.65 3 0.4148301788955146 1.2 4 0.077780658542909 0.3 5 0.025926886180969663 0.125 6 0.025926886180969663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTTATAAT 6 0.15 No Hit CTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.6375 0.0 0.0 0.0 0.0 74-75 0.8625 0.0 0.0 0.0 0.0 76-77 1.15 0.0 0.0 0.0 0.0 78-79 1.45 0.0 0.0 0.0 0.0 80-81 1.95 0.0 0.0 0.0 0.0 82-83 2.2625 0.0 0.0 0.0 0.0 84-85 2.875 0.0 0.0 0.0 0.0 86-87 3.7875 0.0 0.0 0.0 0.0 88-89 4.5125 0.0 0.0 0.0 0.0 90-91 5.35 0.0 0.0 0.0 0.0 92-93 6.5625 0.0 0.0 0.0 0.0 94-95 7.725 0.0 0.0 0.0 0.0 96-97 9.1375 0.0 0.0 0.0 0.0 98-99 10.5625 0.0 0.0 0.0 0.0 100-101 12.175 0.0 0.0 0.0 0.0 102-103 13.475 0.0 0.0 0.0 0.0 104-105 15.287500000000001 0.0 0.0 0.0 0.0 106-107 17.2625 0.0 0.0 0.0 0.0 108-109 18.95 0.0 0.0 0.0 0.0 110-111 20.5875 0.0 0.0 0.0 0.0 112-113 22.487499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGGT 15 0.0041016587 59.437504 36-37 >>END_MODULE SRR6789279 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6789279_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.289 33.0 33.0 34.0 31.0 34.0 2 32.202 33.0 33.0 34.0 31.0 34.0 3 32.225 33.0 33.0 34.0 31.0 34.0 4 31.92875 33.0 33.0 34.0 30.0 34.0 5 32.133 33.0 33.0 34.0 31.0 34.0 6 36.217 38.0 38.0 38.0 33.0 38.0 7 36.2465 38.0 38.0 38.0 33.0 38.0 8 36.11625 38.0 38.0 38.0 33.0 38.0 9 36.228 38.0 38.0 38.0 33.0 38.0 10-11 36.19225 38.0 38.0 38.0 33.0 38.0 12-13 35.77075 38.0 38.0 38.0 31.0 38.0 14-15 35.12075 38.0 37.5 38.0 28.5 38.0 16-17 35.308375 38.0 37.5 38.0 28.5 38.0 18-19 35.576625 38.0 38.0 38.0 30.0 38.0 20-21 35.30975 38.0 37.5 38.0 28.5 38.0 22-23 35.493875 38.0 37.0 38.0 28.5 38.0 24-25 35.856125000000006 38.0 37.5 38.0 30.0 38.0 26-27 36.097375 38.0 38.0 38.0 32.5 38.0 28-29 36.193 38.0 38.0 38.0 33.0 38.0 30-31 36.313875 38.0 38.0 38.0 33.0 38.0 32-33 36.1155 38.0 38.0 38.0 33.0 38.0 34-35 36.245625000000004 38.0 38.0 38.0 33.0 38.0 36-37 36.140625 38.0 38.0 38.0 33.0 38.0 38-39 36.144625 38.0 38.0 38.0 33.0 38.0 40-41 36.105125 38.0 38.0 38.0 33.0 38.0 42-43 36.061625 38.0 38.0 38.0 32.5 38.0 44-45 35.95425 38.0 37.5 38.0 32.0 38.0 46-47 35.805 38.0 37.5 38.0 30.0 38.0 48-49 35.826125000000005 38.0 37.5 38.0 30.0 38.0 50-51 35.985875 38.0 37.5 38.0 31.0 38.0 52-53 36.108625 38.0 38.0 38.0 32.5 38.0 54-55 36.07 38.0 38.0 38.0 33.0 38.0 56-57 35.894875 38.0 37.5 38.0 31.5 38.0 58-59 35.8775 38.0 37.0 38.0 30.5 38.0 60-61 35.957499999999996 38.0 37.5 38.0 32.0 38.0 62-63 35.900875 38.0 37.0 38.0 31.0 38.0 64-65 35.74575 38.0 37.0 38.0 30.0 38.0 66-67 35.783 38.0 37.0 38.0 30.0 38.0 68-69 35.56575 38.0 37.0 38.0 29.0 38.0 70-71 35.75475 38.0 37.0 38.0 30.0 38.0 72-73 35.59525 38.0 37.0 38.0 29.5 38.0 74-75 35.73025 38.0 37.0 38.0 29.0 38.0 76-77 35.568375 38.0 37.0 38.0 29.0 38.0 78-79 35.5475 38.0 37.0 38.0 29.0 38.0 80-81 35.608625 38.0 37.0 38.0 30.0 38.0 82-83 35.51 38.0 37.0 38.0 29.0 38.0 84-85 35.358000000000004 38.0 36.5 38.0 29.0 38.0 86-87 35.408 38.0 37.0 38.0 29.0 38.0 88-89 35.377250000000004 38.0 36.0 38.0 29.0 38.0 90-91 35.312875000000005 38.0 36.0 38.0 28.0 38.0 92-93 35.213 38.0 36.0 38.0 28.0 38.0 94-95 35.0865 38.0 36.0 38.0 27.0 38.0 96-97 34.940250000000006 38.0 36.0 38.0 26.0 38.0 98-99 35.0235 38.0 36.0 38.0 26.5 38.0 100-101 34.98025 38.0 36.0 38.0 27.0 38.0 102-103 34.94175 38.0 35.0 38.0 27.0 38.0 104-105 34.743624999999994 38.0 35.0 38.0 24.5 38.0 106-107 34.667125 38.0 35.0 38.0 23.5 38.0 108-109 34.6755 38.0 35.0 38.0 23.5 38.0 110-111 34.63875 38.0 35.0 38.0 23.5 38.0 112-113 34.4705 38.0 35.0 38.0 23.5 38.0 114-115 34.39675 38.0 34.5 38.0 23.5 38.0 116-117 34.217875 38.0 34.5 38.0 22.0 38.0 118-119 34.1425 38.0 34.0 38.0 23.0 38.0 120-121 34.075625 38.0 34.0 38.0 22.0 38.0 122-123 34.103875 38.0 34.0 38.0 22.0 38.0 124-125 33.951625 38.0 34.0 38.0 21.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1110 1 0.0 1110 2 0.0 1110 3 0.0 1110 4 0.0 1110 5 0.0 1110 6 0.0 1110 7 0.0 1110 8 0.0 1110 9 0.0 1110 10-11 0.0 1110 12-13 0.0 1110 14-15 0.0 1110 16-17 0.0 1110 18-19 0.0 1110 20-21 0.0 1110 22-23 0.0 1110 24-25 0.0 1110 26-27 0.0 1110 28-29 0.0 1110 30-31 0.0 1110 32-33 0.0 1110 34-35 0.0 1110 36-37 0.0 1110 38-39 0.0 1110 40-41 0.0 1110 42-43 0.0 1110 44-45 0.0 1110 46-47 0.0 1110 48-49 0.0 1110 50-51 0.0 1110 52-53 0.0 1110 54-55 0.0 1110 56-57 0.0 1110 58-59 0.0 1110 60-61 0.0 1110 62-63 0.0 1110 64-65 0.0 1110 66-67 0.0 1110 68-69 0.0 1110 70-71 0.0 1110 72-73 0.0 1110 74-75 0.0 1110 76-77 0.0 1110 78-79 0.0 1110 80-81 0.0 1110 82-83 0.0 1110 84-85 0.0 1110 86-87 0.0 1110 88-89 0.0 1110 90-91 0.0 1110 92-93 0.0 1110 94-95 0.0 1110 96-97 0.0 1110 98-99 0.0 1110 100-101 0.0 1110 102-103 0.0 1110 104-105 0.0 1110 106-107 0.0 1110 108-109 0.0 1110 110-111 0.0 1110 112-113 0.0 1110 114-115 0.0 1110 116-117 0.0 1110 118-119 0.0 1110 120-121 0.0 1110 122-123 0.0 1110 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 8.0 18 5.0 19 5.0 20 14.0 21 14.0 22 22.0 23 23.0 24 31.0 25 35.0 26 48.0 27 41.0 28 60.0 29 74.0 30 77.0 31 101.0 32 110.0 33 153.0 34 221.0 35 289.0 36 494.0 37 2159.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.92078215091502 19.37829029832038 7.06944096264728 29.631486588117323 2 27.539503386004515 21.093554050664657 30.80010032605969 20.566842237271132 3 22.74893403561575 24.078254326561325 27.48934035615751 25.68347128166541 4 26.593075765178124 31.309583542398396 20.296036126442548 21.801304565980935 5 27.263606721846003 33.308251818409836 19.162277401555052 20.265864058189116 6 24.604966139954854 34.68773513920241 17.682468021068473 23.024830699774267 7 23.169508525576727 17.226680040120364 34.52858575727182 25.075225677031092 8 22.868605817452355 20.737211634904714 23.796389167502507 32.59779338014042 9 23.019057171514543 20.561685055165498 26.930792377131397 29.488465396188566 10-11 27.262471797442966 26.134369516169464 19.578841814991225 27.02431687139634 12-13 26.615150747403092 21.015961489739045 23.701545477577906 28.66734228527996 14-15 25.733109417387933 24.02790337165741 24.802997028807646 25.435990182147012 16-17 26.981277250577072 23.608617594254937 24.211336240061556 25.19876891510644 18-19 27.368823229750383 24.337748344370862 22.491085073866532 25.802343352012226 20-21 27.72657450076805 23.668714797747057 23.963133640552993 24.641577060931898 22-23 26.137083491701507 23.590523248447994 24.705435195743064 25.566958064107435 24-25 26.891178688112593 24.34028650414677 22.819803970846948 25.94873083689369 26-27 25.80160320641283 24.473947895791586 23.935370741482966 25.789078156312623 28-29 26.443692847300515 24.0511086057873 23.5249906050357 25.980207941876486 30-31 26.34678025557504 24.24204460035079 24.141819092959157 25.26935605111501 32-33 25.501002004008015 24.67434869739479 23.86022044088176 25.964428857715433 34-35 27.166833667334668 24.07314629258517 23.15881763527054 25.60120240480962 36-37 27.637183663242293 23.653219744424955 23.891255324480078 24.818341267852666 38-39 26.59401227608668 23.512463985970186 24.664912939997492 25.228610797945635 40-41 27.28412081714501 23.712244642185738 24.52688306805364 24.476751472615614 42-43 26.396893009270862 23.452768729641694 24.743172137308946 25.407166123778502 44-45 26.751033705049494 23.317879964916678 24.495677233429394 25.435409096604435 46-47 26.46026573075959 24.52995738280271 23.89069942341439 25.119077463023316 48-49 27.97544475068905 23.101979453770983 24.066649962415436 24.85592583312453 50-51 26.164829659318638 24.9749498997996 24.04809619238477 24.812124248496996 52-53 26.80025046963056 24.157795867251096 25.360050093926112 23.681903569192237 54-55 27.86206896551724 22.971786833855802 23.711598746081506 25.454545454545453 56-57 25.802407221664996 24.699097291875628 24.423269809428287 25.075225677031092 58-59 26.776983828506957 24.13187915256362 24.49542434499185 24.59571267393757 60-61 26.80541624874624 23.771313941825476 24.398194583751255 25.02507522567703 62-63 26.739375705152312 23.705653754544315 25.485771593330824 24.069198946972545 64-65 26.54212637913741 24.686559679037114 24.5987963891675 24.172517552657975 66-67 26.629889669007024 24.147442326980944 24.385656970912738 24.837011033099298 68-69 26.26693426994481 23.94631209232313 24.7491219267436 25.03763171098846 70-71 26.768690416457602 23.95885599598595 24.07175112895133 25.200702458605118 72-73 26.455092824887107 24.34771700953337 25.05017561465128 24.14701455092825 74-75 26.116407425990968 23.933768188660313 25.388861013547416 24.560963371801304 76-77 27.00702458605118 24.13447064726543 24.14701455092825 24.711490215755145 78-79 26.47685940047661 24.118901291860027 24.219239934779882 25.184999372883482 80-81 26.317109884596086 24.33517310587055 24.636226793778224 24.711490215755145 82-83 26.379829402910186 24.12192674360261 24.824385348720522 24.67385850476668 84-85 26.95106649937265 24.81806775407779 23.651191969887076 24.579673776662485 86-87 26.73105870546914 24.67385850476668 23.845960863020572 24.7491219267436 88-89 28.07677832141513 24.21277129594781 24.087316522393674 23.62313386024338 90-91 27.483692925238334 24.611138986452584 23.89613647767185 24.00903161063723 92-93 27.132463622679374 24.485699949824387 24.573507275464124 23.808329152032112 94-95 27.51568381430364 24.78042659974906 24.052697616060225 23.651191969887076 96-97 28.616233847697902 24.438589888345252 23.472588131978423 23.472588131978423 98-99 26.95106649937265 24.680050188205772 23.70138017565872 24.66750313676286 100-101 28.10539523212045 26.198243412797993 22.622333751568384 23.074027603513176 102-103 27.499686363066118 25.944047170994857 23.53531551875549 23.02095094718354 104-105 27.63768661397566 26.320411491657257 22.882950696273994 23.158951198093085 106-107 29.179216867469883 25.978915662650603 22.766064257028113 22.075803212851405 108-109 29.012423139666204 24.909022462040404 24.28159116576735 21.796963232526036 110-111 29.121706398996235 25.633626097867 22.47176913425345 22.77289836888331 112-113 29.657508468197214 26.797139631162963 21.90440346255175 21.64094843808807 114-115 30.030105368790768 26.6432513798294 22.353236327145005 20.973406924234823 116-117 30.476787954830613 25.972396486825595 22.572145545796737 20.978670012547052 118-119 31.815330573328314 25.95659264835027 21.91694893990716 20.311127838414254 120-121 30.42659974905897 26.787954830614808 21.994981179422833 20.79046424090339 122-123 31.535373808329155 25.90316106372303 22.277972905168088 20.283492222779728 124-125 30.93714715844938 26.18241124074771 22.19294944172626 20.687492159076655 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 2.5 27 2.5 28 3.5 29 3.5 30 7.5 31 9.0 32 12.0 33 18.0 34 23.5 35 37.0 36 49.5 37 60.5 38 68.0 39 80.5 40 102.0 41 121.5 42 135.0 43 134.0 44 139.5 45 137.5 46 131.0 47 155.5 48 154.5 49 145.0 50 127.0 51 121.5 52 129.5 53 110.5 54 124.0 55 137.5 56 120.5 57 127.0 58 131.0 59 123.0 60 117.0 61 103.0 62 106.5 63 93.5 64 74.0 65 70.0 66 65.5 67 63.0 68 55.0 69 54.5 70 53.5 71 37.5 72 29.5 73 28.0 74 21.0 75 10.5 76 7.5 77 6.5 78 2.0 79 1.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.325 3 0.325 4 0.35000000000000003 5 0.325 6 0.325 7 0.3 8 0.3 9 0.3 10-11 0.27499999999999997 12-13 1.325 14-15 3.2375000000000003 16-17 2.5250000000000004 18-19 1.8499999999999999 20-21 2.35 22-23 1.3375 24-25 0.525 26-27 0.2 28-29 0.21250000000000002 30-31 0.22499999999999998 32-33 0.2 34-35 0.2 36-37 0.22499999999999998 38-39 0.21250000000000002 40-41 0.2625 42-43 0.22499999999999998 44-45 0.2375 46-47 0.27499999999999997 48-49 0.22499999999999998 50-51 0.2 52-53 0.1875 54-55 0.3125 56-57 0.3 58-59 0.2875 60-61 0.3 62-63 0.2875 64-65 0.3 66-67 0.3 68-69 0.35000000000000003 70-71 0.35000000000000003 72-73 0.35000000000000003 74-75 0.35000000000000003 76-77 0.35000000000000003 78-79 0.3375 80-81 0.35000000000000003 82-83 0.35000000000000003 84-85 0.375 86-87 0.35000000000000003 88-89 0.36250000000000004 90-91 0.35000000000000003 92-93 0.35000000000000003 94-95 0.375 96-97 0.36250000000000004 98-99 0.375 100-101 0.375 102-103 0.36250000000000004 104-105 0.36250000000000004 106-107 0.4 108-109 0.3875 110-111 0.375 112-113 0.36250000000000004 114-115 0.35000000000000003 116-117 0.375 118-119 0.36250000000000004 120-121 0.375 122-123 0.35000000000000003 124-125 0.36250000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.0774160471674 95.65 2 1.5380671622660855 3.0 3 0.2819789797487824 0.8250000000000001 4 0.05126890540886952 0.2 5 0.02563445270443476 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02563445270443476 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit GTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.6625 0.0 0.0 0.0 0.0 74-75 0.8875 0.0 0.0 0.0 0.0 76-77 1.175 0.0 0.0 0.0 0.0 78-79 1.475 0.0 0.0 0.0 0.0 80-81 1.9749999999999999 0.0 0.0 0.0 0.0 82-83 2.2874999999999996 0.0 0.0 0.0 0.0 84-85 2.875 0.0 0.0 0.0 0.0 86-87 3.7625 0.0 0.0 0.0 0.0 88-89 4.5125 0.0 0.0 0.0 0.0 90-91 5.3625 0.0 0.0 0.0 0.0 92-93 6.575 0.0 0.0 0.0 0.0 94-95 7.8125 0.0 0.0 0.0 0.0 96-97 9.2625 0.0 0.0 0.0 0.0 98-99 10.6875 0.0 0.0 0.0 0.0 100-101 12.35 0.0 0.0 0.0 0.0 102-103 13.675 0.0 0.0 0.0 0.0 104-105 15.4625 0.0 0.0 0.0 0.0 106-107 17.424999999999997 0.0 0.0 0.0 0.0 108-109 19.2125 0.0 0.0 0.0 0.0 110-111 20.924999999999997 0.0 0.0 0.0 0.0 112-113 22.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799345 spots for SRR6789279.sra Written 1799345 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra Read 1799329 spots for SRR6789279.sra Written 1799329 spots for SRR6789279.sra SRR ids: ['SRR6789279.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_obut2c_r SRR6789279.sra spots: 35986596 blocks: [[1, 1799329], [1799330, 3598658], [3598659, 5397987], [5397988, 7197316], [7197317, 8996645], [8996646, 10795974], [10795975, 12595303], [12595304, 14394632], [14394633, 16193961], [16193962, 17993290], [17993291, 19792619], [19792620, 21591948], [21591949, 23391277], [23391278, 25190606], [25190607, 26989935], [26989936, 28789264], [28789265, 30588593], [30588594, 32387922], [32387923, 34187251], [34187252, 35986596]] SRR6789279 file size 11428107 SRR6789279 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6789279 SRR6789279_1.fastq SRR6789279_2.fastq Input file: SRR6789279_1.fastq Paired file: SRR6789279_2.fastq trimmed: SRR6789279-trimmed-pair1.fastq, SRR6789279-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:43:35 2024 >> started Sat Dec 7 12:44:35 2024 >> done (59.635s) 35986596 read pairs processed; of these: 955 ( 0.00%) short read pairs filtered out after trimming by size control 180759 ( 0.50%) empty read pairs filtered out after trimming by size control 35804882 (99.50%) read pairs available; of these: 13170325 (36.78%) trimmed read pairs available after processing 22634557 (63.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 18 0.00% 20 29 0.00% 21 21 0.00% 22 29 0.00% 23 10 0.00% 24 26 0.00% 25 22 0.00% 26 35 0.00% 27 44 0.00% 28 60 0.00% 29 65 0.00% 30 88 0.00% 31 107 0.00% 32 132 0.00% 33 163 0.00% 34 192 0.00% 35 204 0.00% 36 273 0.00% 37 303 0.00% 38 395 0.00% 39 500 0.00% 40 605 0.00% 41 746 0.00% 42 830 0.00% 43 916 0.00% 44 1003 0.00% 45 1203 0.00% 46 1371 0.00% 47 1722 0.00% 48 2064 0.01% 49 2523 0.01% 50 3051 0.01% 51 3585 0.01% 52 3748 0.01% 53 4144 0.01% 54 4440 0.01% 55 4919 0.01% 56 5197 0.01% 57 5898 0.02% 58 6916 0.02% 59 8412 0.02% 60 9972 0.03% 61 11492 0.03% 62 12717 0.04% 63 14196 0.04% 64 15336 0.04% 65 16221 0.05% 66 18011 0.05% 67 19686 0.05% 68 21592 0.06% 69 25014 0.07% 70 29188 0.08% 71 33848 0.09% 72 39654 0.11% 73 44185 0.12% 74 47224 0.13% 75 51824 0.14% 76 53887 0.15% 77 57138 0.16% 78 62706 0.18% 79 70950 0.20% 80 81682 0.23% 81 96054 0.27% 82 102692 0.29% 83 114154 0.32% 84 123365 0.34% 85 130214 0.36% 86 136034 0.38% 87 142504 0.40% 88 156075 0.44% 89 160708 0.45% 90 170330 0.48% 91 193060 0.54% 92 208908 0.58% 93 230373 0.64% 94 241672 0.67% 95 251817 0.70% 96 269530 0.75% 97 258683 0.72% 98 257448 0.72% 99 265459 0.74% 100 274786 0.77% 101 296131 0.83% 102 314581 0.88% 103 336309 0.94% 104 352486 0.98% 105 351770 0.98% 106 350991 0.98% 107 343267 0.96% 108 342295 0.96% 109 339525 0.95% 110 343001 0.96% 111 350094 0.98% 112 374092 1.04% 113 383952 1.07% 114 393758 1.10% 115 402051 1.12% 116 390578 1.09% 117 375074 1.05% 118 356045 0.99% 119 350325 0.98% 120 350782 0.98% 121 351853 0.98% 122 359086 1.00% 123 380967 1.06% 124 394889 1.10% 125 22634557 63.22% 35804882 reads passed initial QC criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=17 prefix-density=1.11 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.31 sequence-density-rank=28 fanout-score=11.83 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=4.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=16 prefix-density=1.21 prefix-fanout=2.7 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATTATGATAATTTACCGGT criterion=fanout-score sequence-density=0.32 sequence-density-rank=19 fanout-score=13.47 fanout-score-rank=1 prefix-density=1.49 prefix-fanout=2.9 sequence=CATGTTCGGGTTCTTCGT SRR6789279 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:45:06 Started mapping on | Dec 07 12:45:12 Finished on | Dec 07 12:47:00 Mapping speed, Million of reads per hour | 1193.50 Number of input reads | 35804882 Average input read length | 234 UNIQUE READS: Uniquely mapped reads number | 30693119 Uniquely mapped reads % | 85.72% Average mapped length | 234.16 Number of splices: Total | 17896988 Number of splices: Annotated (sjdb) | 16854607 Number of splices: GT/AG | 17650787 Number of splices: GC/AG | 206920 Number of splices: AT/AC | 4646 Number of splices: Non-canonical | 34635 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2415852 % of reads mapped to multiple loci | 6.75% Number of reads mapped to too many loci | 400815 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 4.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2722014 2722014 2722014 N_multimapping 2415852 2415852 2415852 N_noFeature 1502107 29032639 2456604 N_ambiguous 808670 4756 102806 UnstrandedReadsAssigned:28382342 PositiveStrandReadsAssigned:1655724 NegativeStrandReadsAssigned:28133709 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=108 echo kmer=103 SRR6789279 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6789279-trimmed-pair1.fastq SRR6789279-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,804,882 reads, 28,739,323 reads pseudoaligned [quant] estimated average fragment length: 147.455 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,295 rounds 52973 SRR6789279.ke.tsv 35125 SRR6789279.se.tsv 88098 total ==> SRR6789279.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 789.645 0 0 PNS24247 1044 897.545 40.0364 2.01443 PNS24249 1928 1781.55 57.9731 1.46955 PNS24246 1044 897.545 40.0364 2.01443 PNS24248 1044 897.545 40.0364 2.01443 PNS24244 1471 1324.55 190.918 6.5093 PNS24243 293 150.902 0 0 KQK14069 1603 1456.55 19702.3 610.868 KQK14071 474 328.315 1753.55 241.203 ==> SRR6789279.se.tsv <== BRADI_1g14170v3 24676 BRADI_1g53295v3 28 BRADI_1g59795v3 1788 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 208 BRADI_1g74790v3 177 BRADI_1g09890v3 0 BRADI_1g77505v3 494 BRADI_1g48960v3 0 SRR6789279 completed mapping pipeline successfully