Starting /dee2/code/volunteer_pipeline.sh SRR6892953 current disk space = 1551086354432 free memory = 1595863188 SRR6892953 SRAfilesize 47ed4d8b914950528e8ad5c3259902f8 SRR6892953.sra SRR6892953.sra file validated SRR6892953 is single end SRR6892953 is conventional basespace SRR6892953 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6892953_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.83625 31.0 28.0 31.0 12.0 34.0 2 29.0275 31.0 28.0 34.0 16.0 34.0 3 29.65275 31.0 29.0 34.0 26.0 34.0 4 33.36175 35.0 33.0 37.0 28.0 37.0 5 32.7515 35.0 33.0 37.0 26.0 37.0 6 32.835 35.0 33.0 37.0 26.0 37.0 7 32.68075 35.0 33.0 37.0 26.0 37.0 8 32.42925 35.0 32.0 37.0 25.0 37.0 9 33.5855 37.0 32.0 39.0 23.0 39.0 10 33.779 37.0 33.0 39.0 26.0 39.0 11 33.45225 37.0 33.0 39.0 23.0 39.0 12 33.39975 37.0 32.0 39.0 23.0 39.0 13 33.3055 37.0 32.0 39.0 23.0 39.0 14 33.96525 38.0 32.0 40.0 21.0 41.0 15 33.62725 38.0 32.0 40.0 18.0 41.0 16 33.67325 38.0 32.0 40.0 20.0 41.0 17 33.174 38.0 32.0 40.0 17.0 41.0 18 33.24725 37.0 32.0 40.0 17.0 41.0 19 33.2345 38.0 32.0 40.0 17.0 41.0 20 32.6095 37.0 31.0 40.0 11.0 41.0 21 33.1795 37.0 32.0 40.0 18.0 41.0 22 32.9715 38.0 32.0 40.0 13.0 41.0 23 33.00125 38.0 32.0 40.0 10.0 41.0 24 30.923 36.0 30.0 39.0 2.0 40.0 25 29.43225 34.0 26.0 38.0 2.0 39.0 26 30.02725 35.0 27.0 38.0 2.0 40.0 27 30.79925 36.0 29.0 39.0 2.0 40.0 28 31.48925 37.0 30.0 39.0 2.0 40.0 29 32.24075 37.0 32.0 39.0 2.0 40.0 30 31.80275 37.0 31.0 40.0 2.0 40.0 31 29.3465 35.0 25.0 38.0 2.0 40.0 32 28.10625 33.0 25.0 37.0 2.0 39.0 33 29.971 35.0 29.0 38.0 2.0 40.0 34 31.42375 37.0 31.0 39.0 2.0 40.0 35 29.61125 35.0 28.0 39.0 2.0 40.0 36 27.93325 34.0 24.0 38.0 2.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 111.0 3 3.0 4 20.0 5 13.0 6 11.0 7 10.0 8 9.0 9 14.0 10 15.0 11 23.0 12 13.0 13 19.0 14 23.0 15 25.0 16 29.0 17 16.0 18 21.0 19 28.0 20 29.0 21 33.0 22 36.0 23 53.0 24 50.0 25 54.0 26 60.0 27 89.0 28 82.0 29 124.0 30 103.0 31 164.0 32 172.0 33 229.0 34 279.0 35 383.0 36 468.0 37 574.0 38 554.0 39 61.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.924387646432375 26.277955271565496 32.880724174653885 26.916932907348247 2 19.6 23.45 29.975 26.974999999999998 3 24.15 23.400000000000002 28.125 24.325 4 24.349999999999998 27.150000000000002 25.924999999999997 22.575 5 22.336168084042022 28.88944472236118 26.138069034517258 22.63631815907954 6 22.88072018004501 23.58089522380595 29.232308077019255 24.306076519129782 7 23.78094523630908 25.55638909727432 29.28232058014504 21.380345086271568 8 24.33108277069267 23.23080770192548 30.15753938484621 22.280570142535634 9 27.0 23.575 29.225 20.200000000000003 10 28.107026756689173 23.455863965991497 27.106776694173547 21.330332583145786 11 26.231557889472366 25.531382845711427 25.506376594148538 22.73068267066767 12 26.981745436359088 23.755938984746187 25.95648912228057 23.305826456614152 13 25.987993996998497 23.23661830915458 26.113056528264135 24.662331165582792 14 25.337668834417208 23.51175587793897 26.863431715857928 24.287143571785894 15 25.506376594148538 23.95598899724931 29.08227056764191 21.45536384096024 16 27.5887943971986 22.511255627813906 28.31415707853927 21.585792896448226 17 27.63881940970485 21.585792896448226 27.313656828414207 23.461730865432717 18 31.465732866433214 22.211105552776388 25.962981490745374 20.36018009004502 19 29.347010257693267 20.490367775831874 27.495621716287218 22.66700025018764 20 21.290968226169625 14.686014510883163 35.351513635226425 28.67150362772079 21 6.179634726044533 4.85364023017263 72.57943457593194 16.38729046785089 22 1.1258443832874656 0.12509382036527394 48.586439829872404 50.16262196647485 23 49.71228421315987 0.2501876407305479 0.950713034776082 49.0868151113335 24 51.56367275456593 0.7505629221916438 47.01025769326995 0.6755066299724793 25 1.001001001001001 49.549549549549546 48.52352352352353 0.9259259259259258 26 1.0257693269952466 49.41205904428321 49.11183387540656 0.4503377533149862 27 50.45045045045045 0.2752752752752753 48.47347347347347 0.8008008008008007 28 49.83737803352514 0.2251688766574931 0.2752064048036027 49.66224668501376 29 1.2762762762762763 0.5005005005005005 0.15015015015015015 98.07307307307308 30 50.23767825869402 0.15011258443832876 0.7005253940455342 48.911683762822115 31 51.66374781085814 0.12509382036527394 46.860145108831624 1.3510132599449587 32 1.651238428821616 0.17513134851138354 47.735801851388544 50.43782837127846 33 0.30007501875468867 0.17504376094023505 51.137784446111525 48.38709677419355 34 0.1 0.05 98.9 0.95 35 0.3024193548387097 0.15120967741935484 51.03326612903226 48.51310483870967 36 1.0012515644555695 0.0750938673341677 50.7133917396746 48.21026282853567 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 1.5 22 3.0 23 3.0 24 3.5 25 4.0 26 2.5 27 1.0 28 1.0 29 4.0 30 7.0 31 7.0 32 24.0 33 41.0 34 41.0 35 74.0 36 107.0 37 107.0 38 164.0 39 221.0 40 310.0 41 399.0 42 399.0 43 456.5 44 514.0 45 514.0 46 544.0 47 574.0 48 574.0 49 565.5 50 557.0 51 520.5 52 484.0 53 484.0 54 444.0 55 404.0 56 404.0 57 331.5 58 259.0 59 259.0 60 216.0 61 173.0 62 173.0 63 152.0 64 131.0 65 96.0 66 61.0 67 61.0 68 45.5 69 30.0 70 30.0 71 22.5 72 15.0 73 15.0 74 12.5 75 10.0 76 6.0 77 2.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.1 2 0.0 3 0.0 4 0.0 5 0.05 6 0.025 7 0.025 8 0.025 9 0.0 10 0.025 11 0.025 12 0.025 13 0.05 14 0.05 15 0.025 16 0.05 17 0.05 18 0.05 19 0.075 20 0.075 21 0.075 22 0.075 23 0.075 24 0.075 25 0.1 26 0.075 27 0.1 28 0.075 29 0.1 30 0.075 31 0.075 32 0.075 33 0.025 34 0.0 35 0.8 36 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.97435897435898 96.5 2 0.8461538461538461 1.6500000000000001 3 0.07692307692307693 0.22499999999999998 4 0.02564102564102564 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02564102564102564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05128205128205128 1.35 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTC 33 0.8250000000000001 No Hit CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCT 21 0.525 No Hit ACGACTCTCGGCAACGGATATTCGTATGCCGTCTTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTCT 155 0.0 30.329113 30 ATCGTAT 20 0.004601948 29.95 21 TCTCGTA 40 5.924323E-6 26.206251 20 CTTCGTA 35 0.0025439481 21.392859 20 CTCGTAT 155 0.0 20.288712 21 GTATGCC 390 0.0 18.814743 24 TATGCCG 390 0.0 18.814743 25 CGTATGC 390 0.0 18.814743 23 ACTCGTA 40 0.005520522 18.718752 20 TCGTATG 395 0.0 18.576582 22 CCGTCTT 385 0.0 18.512575 29 TGCCGTC 390 0.0 18.430769 27 ATGCCGT 390 0.0 18.430769 26 GCCGTCT 390 0.0 18.430769 28 CGTCTTC 390 0.0 18.275234 30 TTCGTAT 150 0.0 17.970001 21 GCTCGTA 50 8.795233E-4 17.97 20 GTCGTAT 70 2.0759699E-5 17.114286 20 >>END_MODULE Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027354 spots for SRR6892953.sra Written 6027354 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra Read 6027346 spots for SRR6892953.sra Written 6027346 spots for SRR6892953.sra SRR ids: ['SRR6892953.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8hlpmnpg SRR6892953.sra spots: 120546928 blocks: [[1, 6027346], [6027347, 12054692], [12054693, 18082038], [18082039, 24109384], [24109385, 30136730], [30136731, 36164076], [36164077, 42191422], [42191423, 48218768], [48218769, 54246114], [54246115, 60273460], [60273461, 66300806], [66300807, 72328152], [72328153, 78355498], [78355499, 84382844], [84382845, 90410190], [90410191, 96437536], [96437537, 102464882], [102464883, 108492228], [108492229, 114519574], [114519575, 120546928]] SRR6892953 file size 17671582 SRR6892953 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6892953 SRR6892953_1.fastq Input file: SRR6892953_1.fastq trimmed: SRR6892953-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:32:47 2024 >> started Fri Dec 6 13:33:55 2024 >> done (67.397s) 120546928 reads processed; of these: 4417527 ( 3.66%) short reads filtered out after trimming by size control 4195375 ( 3.48%) empty reads filtered out after trimming by size control 111934026 (92.86%) reads available; of these: 10596695 ( 9.47%) trimmed reads available after processing 101337331 (90.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 429126 0.38% 19 421782 0.38% 20 538583 0.48% 21 1103541 0.99% 22 638954 0.57% 23 448642 0.40% 24 213786 0.19% 25 58484 0.05% 26 45628 0.04% 27 61397 0.05% 28 77534 0.07% 29 625599 0.56% 30 296598 0.26% 31 346067 0.31% 32 85062 0.08% 33 148475 0.13% 34 3214861 2.87% 35 1842576 1.65% 36 101337331 90.53% 111934026 reads passed initial QC criterion=sequence-density sequence-density=90.04 sequence-density-rank=1 fanout-score=40.27 fanout-score-rank=1 prefix-density=92.44 prefix-fanout=39.2 sequence=TCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=90.04 sequence-density-rank=1 fanout-score=40.27 fanout-score-rank=1 prefix-density=92.44 prefix-fanout=39.2 sequence=TCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTG -o SRR6892953 - Input file: STDIN trimmed: SRR6892953-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:37:02 2024 >> started Fri Dec 6 13:38:31 2024 >> done (89.056s) 109473938 reads processed; of these: 83629 ( 0.08%) short reads filtered out after trimming by size control 1260 ( 0.00%) empty reads filtered out after trimming by size control 109389049 (99.92%) reads available; of these: 105872413 (96.79%) trimmed reads available after processing 3516636 ( 3.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 493669 0.45% 19 1005076 0.92% 20 53291352 48.72% 21 53356915 48.78% 22 712489 0.65% 23 354095 0.32% 24 38945 0.04% 25 8878 0.01% 26 4792 0.00% 27 12352 0.01% 28 12304 0.01% 29 14757 0.01% 30 10553 0.01% 31 5203 0.00% 32 2440 0.00% 33 1746 0.00% 34 11167 0.01% 35 6579 0.01% 36 45737 0.04% criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=20 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=22.88 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.8 sequence=CCGGCAAGGCATAAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATA Started job on | Dec 06 13:39:07 Started mapping on | Dec 06 13:39:07 Finished on | Dec 06 13:41:39 Mapping speed, Million of reads per hour | 2649.06 Number of input reads | 111849137 Average input read length | 20 UNIQUE READS: Uniquely mapped reads number | 95241408 Uniquely mapped reads % | 85.15% Average mapped length | 20.41 Number of splices: Total | 2807729 Number of splices: Annotated (sjdb) | 2587487 Number of splices: GT/AG | 2779235 Number of splices: GC/AG | 26174 Number of splices: AT/AC | 931 Number of splices: Non-canonical | 1389 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 10867899 % of reads mapped to multiple loci | 9.72% Number of reads mapped to too many loci | 3042382 % of reads mapped to too many loci | 2.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5739830 5739830 5739830 N_multimapping 10867899 10867899 10867899 N_noFeature 5049628 5885243 92354212 N_ambiguous 2194042 142681 10081 UnstrandedReadsAssigned:87997738 PositiveStrandReadsAssigned:89213484 NegativeStrandReadsAssigned:2877115 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR6892953 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR6892953-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 111,849,137 reads, 87,584,169 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,408 rounds 52973 SRR6892953.ke.tsv 35125 SRR6892953.se.tsv 88098 total ==> SRR6892953.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 9.74898 0.169319 PNS24249 1928 1829 221.711 1.98953 PNS24246 1044 945 9.74898 0.169319 PNS24248 1044 945 9.74898 0.169319 PNS24244 1471 1372 1917.04 22.9327 PNS24243 293 194 0 0 KQK14069 1603 1504 31158.1 340.017 KQK14071 474 375 367.995 16.106 ==> SRR6892953.se.tsv <== BRADI_1g14170v3 31190 BRADI_1g53295v3 130 BRADI_1g59795v3 259 BRADI_1g07683v3 14 BRADI_1g00485v3 77 BRADI_1g20270v3 5819 BRADI_1g74790v3 632 BRADI_1g09890v3 35 BRADI_1g77505v3 2081 BRADI_1g48960v3 15 SRR6892953 completed mapping pipeline successfully